Mutagenetix > Incidental Mutations

Incidental Mutation 'R2019:Itgax'

223631

Institutional Source

Beutler Lab

Gene Symbol

Itgax

Ensembl Gene

ENSMUSG00000030789

Gene Name

integrin alpha X

Synonyms

Cd11c, CD11C (p150) alpha polypeptide

MMRRC Submission

040028-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.077) question?

Stock #

R2019 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

128129547-128150657 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 128148526 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 1038 (H1038R)

Ref Sequence

ENSEMBL: ENSMUSP00000033053 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033053]

Predicted Effect

probably benign
Transcript: ENSMUST00000033053
AA Change: H1038R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000033053
Gene: ENSMUSG00000030789
AA Change: H1038R

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Int_alpha	33	83	1.28e1	SMART
VWA	150	331	8.36e-43	SMART
Int_alpha	402	451	3.67e-3	SMART
Int_alpha	455	512	1.29e-7	SMART
Int_alpha	518	574	5.72e-14	SMART
Int_alpha	581	635	1.55e-1	SMART
transmembrane domain	1115	1137	N/A	INTRINSIC
Pfam:Integrin_alpha	1138	1152	6.2e-7	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206396

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.4%

Validation Efficiency

100% (71/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the integrin alpha X chain protein. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This protein combines with the beta 2 chain (ITGB2) to form a leukocyte-specific integrin referred to as inactivated-C3b (iC3b) receptor 4 (CR4). The alpha X beta 2 complex seems to overlap the properties of the alpha M beta 2 integrin in the adherence of neutrophils and monocytes to stimulated endothelium cells, and in the phagocytosis of complement coated particles. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to bacterial infection, decreased susceptibility to experimental autoimmune encephalomyelitis (EAE), increased T cell proliferation, and an abnormal pattern of cytokine production during EAE. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610028H24Rik	C	A	10: 76,458,065	F252L	possibly damaging	Het
Abcc9	G	A	6: 142,675,434	L527F	probably damaging	Het
Abi3bp	A	G	16: 56,677,796	T918A	probably damaging	Het
Acpp	C	T	9: 104,324,702	G81R	probably damaging	Het
Acss3	C	T	10: 106,936,207	S669N	probably benign	Het
Akt1	T	C	12: 112,659,625	N71S	probably damaging	Het
Amz1	G	T	5: 140,751,964	M326I	probably benign	Het
Ankrd36	A	G	11: 5,689,140	I1351V	probably benign	Het
Art2b	T	C	7: 101,579,987	D235G	probably benign	Het
Ccdc141	A	C	2: 77,011,565	I1507M	probably damaging	Het
Dck	A	G	5: 88,774,084	Y135C	probably damaging	Het
Dmbt1	T	G	7: 131,110,989	I1563S	possibly damaging	Het
Dnttip2	T	C	3: 122,280,744	V610A	possibly damaging	Het
Efhb	A	G	17: 53,401,477	S722P	probably damaging	Het
Emx2	A	G	19: 59,459,339	S42G	probably benign	Het
Ermard	C	T	17: 15,053,265	R371C	probably damaging	Het
Fat1	T	G	8: 45,023,746	I1943S	probably damaging	Het
Fignl1	T	C	11: 11,802,054	K334E	probably damaging	Het
Fmn1	A	C	2: 113,364,480	K175T	unknown	Het
Gm7247	A	T	14: 51,365,347	M47L	possibly damaging	Het
Gpalpp1	A	T	14: 76,110,691		probably null	Het
Hc	A	C	2: 35,013,528	F1038C	probably damaging	Het
Ifngr1	A	T	10: 19,592,113	M10L	probably damaging	Het
Irx5	T	G	8: 92,358,364	Y61D	probably damaging	Het
Jag1	C	T	2: 137,084,679	E982K	probably benign	Het
Klhdc9	T	C	1: 171,358,941	D309G	probably damaging	Het
Lamp3	A	T	16: 19,701,211	M74K	probably benign	Het
Lrpprc	A	T	17: 84,752,331	L685Q	possibly damaging	Het
Magel2	G	A	7: 62,379,096	V583I	unknown	Het
Mgat5b	A	G	11: 116,947,348	Y271C	probably benign	Het
Mtmr6	T	C	14: 60,298,992	M557T	probably benign	Het
Myo16	T	C	8: 10,376,260	L339P	probably benign	Het
Neb	G	T	2: 52,232,276	Y580*	probably null	Het
Npat	A	G	9: 53,562,491	K528E	probably benign	Het
Olfr1032	A	T	2: 86,008,223	Y149F	probably damaging	Het
Olfr1245	A	G	2: 89,575,393	V111A	probably damaging	Het
Olfr350	A	T	2: 36,850,406	Y120F	possibly damaging	Het
Parp8	G	A	13: 116,868,432		probably benign	Het
Phf3	G	A	1: 30,811,847	T1142M	probably damaging	Het
Phospho1	G	A	11: 95,831,106	V201M	probably damaging	Het
Piezo1	A	G	8: 122,482,712	F2371L	probably benign	Het
Pitpnm1	T	C	19: 4,113,641	S1209P	probably damaging	Het
Pkd1	T	A	17: 24,568,684	C20*	probably null	Het
Prdm5	C	A	6: 65,831,356	N95K	probably damaging	Het
Prkx	T	C	X: 77,765,404	D270G	probably damaging	Het
Ptgis	A	G	2: 167,208,279	V310A	probably damaging	Het
Ptgis	G	A	2: 167,214,810	Q286*	probably null	Het
Rpf1	T	A	3: 146,521,221	N59I	probably damaging	Het
Rpl3l	A	C	17: 24,735,516		probably benign	Het
Ryr2	C	T	13: 11,851,188	G292D	possibly damaging	Het
Ryr3	G	T	2: 112,781,065	N2257K	probably benign	Het
Sla	T	C	15: 66,782,555	Y278C	probably damaging	Het
Slc4a10	A	T	2: 62,234,381	D193V	probably damaging	Het
Spire2	T	C	8: 123,332,918	C52R	probably damaging	Het
Tada2b	T	C	5: 36,483,906	Y51C	probably damaging	Het
Tarbp1	C	T	8: 126,428,114	V1424I	probably damaging	Het
Tbpl1	T	A	10: 22,707,677	E131D	probably damaging	Het
Tgfbrap1	A	G	1: 43,054,517		probably null	Het
Tmem116	A	G	5: 121,489,254	I151M	possibly damaging	Het
Tmem30a	T	C	9: 79,774,218	D223G	probably damaging	Het
Trim13	T	A	14: 61,604,886	C117*	probably null	Het
Ttn	C	G	2: 76,755,332	D21987H	probably damaging	Het
Txnrd1	G	A	10: 82,877,373	V90I	probably benign	Het
Unc79	G	A	12: 103,171,571		probably null	Het
Upp1	A	T	11: 9,133,240	M111L	possibly damaging	Het
Vmn2r79	G	T	7: 87,002,426	L344F	probably benign	Het
Vps39	T	C	2: 120,343,227	Y147C	probably damaging	Het
Wdr59	A	G	8: 111,466,793	Y666H	probably damaging	Het
Wdr95	A	G	5: 149,574,148		probably benign	Het

Other mutations in Itgax

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Itgax	APN	7	128135326	missense	probably damaging	1.00
IGL00325:Itgax	APN	7	128148309	missense	possibly damaging	0.69
IGL01155:Itgax	APN	7	128145035	missense	probably benign	0.00
IGL01461:Itgax	APN	7	128135018	missense	probably damaging	1.00
IGL01508:Itgax	APN	7	128144818	missense	probably damaging	1.00
IGL01549:Itgax	APN	7	128131206	splice site	probably null
IGL01864:Itgax	APN	7	128133763	missense	probably benign	0.00
IGL02094:Itgax	APN	7	128131473	missense	probably damaging	1.00
IGL02364:Itgax	APN	7	128139982	missense	possibly damaging	0.89
IGL02969:Itgax	APN	7	128149123	missense	probably benign
IGL03406:Itgax	APN	7	128149198	missense	possibly damaging	0.93
Adendritic	UTSW	7	128148572	nonsense	probably null
PIT4651001:Itgax	UTSW	7	128149110	missense	probably benign	0.11
R0366:Itgax	UTSW	7	128149089	splice site	probably benign
R0763:Itgax	UTSW	7	128147940	splice site	probably benign
R1072:Itgax	UTSW	7	128150144	missense	probably damaging	0.96
R1659:Itgax	UTSW	7	128130891	missense	probably benign	0.15
R2418:Itgax	UTSW	7	128142333	missense	probably damaging	0.98
R3027:Itgax	UTSW	7	128148572	nonsense	probably null
R3846:Itgax	UTSW	7	128133767	missense	probably damaging	1.00
R3938:Itgax	UTSW	7	128136273	missense	possibly damaging	0.73
R4021:Itgax	UTSW	7	128133139	critical splice donor site	probably null
R4027:Itgax	UTSW	7	128141266	missense	possibly damaging	0.75
R4163:Itgax	UTSW	7	128144700	missense	probably benign	0.00
R4923:Itgax	UTSW	7	128148528	missense	probably benign
R5259:Itgax	UTSW	7	128148278	missense	probably damaging	0.99
R5333:Itgax	UTSW	7	128142283	missense	probably damaging	1.00
R5347:Itgax	UTSW	7	128141302	missense	probably benign	0.08
R5679:Itgax	UTSW	7	128134990	missense	probably benign	0.00
R5725:Itgax	UTSW	7	128147861	missense	possibly damaging	0.63
R5733:Itgax	UTSW	7	128140475	missense	probably damaging	0.99
R5750:Itgax	UTSW	7	128144706	missense	probably benign	0.32
R5964:Itgax	UTSW	7	128140447	missense	probably damaging	1.00
R6004:Itgax	UTSW	7	128131452	missense	probably damaging	0.96
R6168:Itgax	UTSW	7	128133097	missense	probably damaging	0.99
R6212:Itgax	UTSW	7	128130332	missense	possibly damaging	0.52
R6212:Itgax	UTSW	7	128147853	missense	probably benign	0.16
R6480:Itgax	UTSW	7	128148599	missense	probably benign	0.12
R6484:Itgax	UTSW	7	128133718	missense	probably benign	0.13
R6796:Itgax	UTSW	7	128135064	missense	probably damaging	1.00
R6844:Itgax	UTSW	7	128147934	splice site	probably null
R7287:Itgax	UTSW	7	128148505	missense	probably damaging	1.00
R7365:Itgax	UTSW	7	128135309	missense	probably damaging	1.00
R7421:Itgax	UTSW	7	128140432	missense	probably damaging	1.00
R7599:Itgax	UTSW	7	128148090	missense	probably damaging	0.99
R7710:Itgax	UTSW	7	128135856	missense	probably benign	0.04
R7964:Itgax	UTSW	7	128140418	critical splice acceptor site	probably null
R8220:Itgax	UTSW	7	128130918	missense	probably benign	0.00
X0061:Itgax	UTSW	7	128129607	start gained	probably benign
Z1176:Itgax	UTSW	7	128144872	missense	probably benign	0.24
Z1177:Itgax	UTSW	7	128148062	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- AAAAGAGTCCCGTGCTGGTG -3'
(R):5'- GTTCAAAGACTGCCCTGACC -3'

Sequencing Primer
(F):5'- TCCCGTGCTGGTGAGGAAAAC -3'
(R):5'- ACTGCCCTGACCCAAGGATG -3'

Posted On

2014-08-25