Incidental Mutation 'R2019:Lrpprc'
ID 223713
Institutional Source Beutler Lab
Gene Symbol Lrpprc
Ensembl Gene ENSMUSG00000024120
Gene Name leucine-rich PPR-motif containing
Synonyms Lrp130, 3110001K13Rik
MMRRC Submission 040028-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2019 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 85012675-85098214 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 85059759 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 685 (L685Q)
Ref Sequence ENSEMBL: ENSMUSP00000107927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112308]
AlphaFold Q6PB66
Predicted Effect possibly damaging
Transcript: ENSMUST00000112308
AA Change: L685Q

PolyPhen 2 Score 0.561 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000107927
Gene: ENSMUSG00000024120
AA Change: L685Q

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 32 50 N/A INTRINSIC
low complexity region 123 136 N/A INTRINSIC
Pfam:PPR_3 196 228 9.1e-4 PFAM
Pfam:PPR 197 227 2.3e-4 PFAM
Pfam:PPR_3 231 264 7.9e-6 PFAM
Pfam:PPR 232 262 4e-4 PFAM
Pfam:PPR_3 266 297 9.7e-3 PFAM
internal_repeat_2 391 477 3.13e-7 PROSPERO
Pfam:PPR 750 778 3.4e-4 PFAM
low complexity region 1017 1028 N/A INTRINSIC
internal_repeat_1 1042 1362 1.09e-11 PROSPERO
low complexity region 1366 1375 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160011
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160414
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a leucine-rich protein that has multiple pentatricopeptide repeats (PPR). The precise role of this protein is unknown but studies suggest it may play a role in cytoskeletal organization, vesicular transport, or in transcriptional regulation of both nuclear and mitochondrial genes. The protein localizes primarily to mitochondria and is predicted to have an N-terminal mitochondrial targeting sequence. Mutations in this gene are associated with the French-Canadian type of Leigh syndrome. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit embryonic lethality during organogenesis associated with growth retardation. Mice homozygous for a knock-out allele exhibit embryonic lethality between somite formation and embryo turning. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted(3) Gene trapped(10)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik C A 10: 76,293,899 (GRCm39) F252L possibly damaging Het
Abcc9 G A 6: 142,621,160 (GRCm39) L527F probably damaging Het
Abi3bp A G 16: 56,498,159 (GRCm39) T918A probably damaging Het
Acp3 C T 9: 104,201,901 (GRCm39) G81R probably damaging Het
Acss3 C T 10: 106,772,068 (GRCm39) S669N probably benign Het
Akt1 T C 12: 112,626,059 (GRCm39) N71S probably damaging Het
Amz1 G T 5: 140,737,719 (GRCm39) M326I probably benign Het
Ankrd36 A G 11: 5,639,140 (GRCm39) I1351V probably benign Het
Art2b T C 7: 101,229,194 (GRCm39) D235G probably benign Het
Ccdc141 A C 2: 76,841,909 (GRCm39) I1507M probably damaging Het
Dck A G 5: 88,921,943 (GRCm39) Y135C probably damaging Het
Dmbt1 T G 7: 130,712,718 (GRCm39) I1563S possibly damaging Het
Dnttip2 T C 3: 122,074,393 (GRCm39) V610A possibly damaging Het
Efhb A G 17: 53,708,505 (GRCm39) S722P probably damaging Het
Emx2 A G 19: 59,447,771 (GRCm39) S42G probably benign Het
Ermard C T 17: 15,273,527 (GRCm39) R371C probably damaging Het
Fat1 T G 8: 45,476,783 (GRCm39) I1943S probably damaging Het
Fignl1 T C 11: 11,752,054 (GRCm39) K334E probably damaging Het
Fmn1 A C 2: 113,194,825 (GRCm39) K175T unknown Het
Gm7247 A T 14: 51,602,804 (GRCm39) M47L possibly damaging Het
Gpalpp1 A T 14: 76,348,131 (GRCm39) probably null Het
Hc A C 2: 34,903,540 (GRCm39) F1038C probably damaging Het
Ifngr1 A T 10: 19,467,861 (GRCm39) M10L probably damaging Het
Irx5 T G 8: 93,084,992 (GRCm39) Y61D probably damaging Het
Itgax A G 7: 127,747,698 (GRCm39) H1038R probably benign Het
Jag1 C T 2: 136,926,599 (GRCm39) E982K probably benign Het
Klhdc9 T C 1: 171,186,509 (GRCm39) D309G probably damaging Het
Lamp3 A T 16: 19,519,961 (GRCm39) M74K probably benign Het
Magel2 G A 7: 62,028,844 (GRCm39) V583I unknown Het
Mgat5b A G 11: 116,838,174 (GRCm39) Y271C probably benign Het
Mtmr6 T C 14: 60,536,441 (GRCm39) M557T probably benign Het
Myo16 T C 8: 10,426,260 (GRCm39) L339P probably benign Het
Neb G T 2: 52,122,288 (GRCm39) Y580* probably null Het
Npat A G 9: 53,473,791 (GRCm39) K528E probably benign Het
Or1j4 A T 2: 36,740,418 (GRCm39) Y120F possibly damaging Het
Or4a72 A G 2: 89,405,737 (GRCm39) V111A probably damaging Het
Or5m3 A T 2: 85,838,567 (GRCm39) Y149F probably damaging Het
Parp8 G A 13: 117,004,968 (GRCm39) probably benign Het
Phf3 G A 1: 30,850,928 (GRCm39) T1142M probably damaging Het
Phospho1 G A 11: 95,721,932 (GRCm39) V201M probably damaging Het
Piezo1 A G 8: 123,209,451 (GRCm39) F2371L probably benign Het
Pitpnm1 T C 19: 4,163,641 (GRCm39) S1209P probably damaging Het
Pkd1 T A 17: 24,787,658 (GRCm39) C20* probably null Het
Prdm5 C A 6: 65,808,340 (GRCm39) N95K probably damaging Het
Prkx T C X: 76,809,010 (GRCm39) D270G probably damaging Het
Ptgis A G 2: 167,050,199 (GRCm39) V310A probably damaging Het
Ptgis G A 2: 167,056,730 (GRCm39) Q286* probably null Het
Rpf1 T A 3: 146,226,976 (GRCm39) N59I probably damaging Het
Rpl3l A C 17: 24,954,490 (GRCm39) probably benign Het
Ryr2 C T 13: 11,866,074 (GRCm39) G292D possibly damaging Het
Ryr3 G T 2: 112,611,410 (GRCm39) N2257K probably benign Het
Sla T C 15: 66,654,404 (GRCm39) Y278C probably damaging Het
Slc4a10 A T 2: 62,064,725 (GRCm39) D193V probably damaging Het
Spire2 T C 8: 124,059,657 (GRCm39) C52R probably damaging Het
Tada2b T C 5: 36,641,250 (GRCm39) Y51C probably damaging Het
Tarbp1 C T 8: 127,154,853 (GRCm39) V1424I probably damaging Het
Tbpl1 T A 10: 22,583,576 (GRCm39) E131D probably damaging Het
Tgfbrap1 A G 1: 43,093,677 (GRCm39) probably null Het
Tmem116 A G 5: 121,627,317 (GRCm39) I151M possibly damaging Het
Tmem30a T C 9: 79,681,500 (GRCm39) D223G probably damaging Het
Trim13 T A 14: 61,842,335 (GRCm39) C117* probably null Het
Ttn C G 2: 76,585,676 (GRCm39) D21987H probably damaging Het
Txnrd1 G A 10: 82,713,207 (GRCm39) V90I probably benign Het
Unc79 G A 12: 103,137,830 (GRCm39) probably null Het
Upp1 A T 11: 9,083,240 (GRCm39) M111L possibly damaging Het
Vmn2r79 G T 7: 86,651,634 (GRCm39) L344F probably benign Het
Vps39 T C 2: 120,173,708 (GRCm39) Y147C probably damaging Het
Wdr59 A G 8: 112,193,425 (GRCm39) Y666H probably damaging Het
Wdr95 A G 5: 149,497,613 (GRCm39) probably benign Het
Other mutations in Lrpprc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Lrpprc APN 17 85,057,953 (GRCm39) missense possibly damaging 0.91
IGL01319:Lrpprc APN 17 85,012,840 (GRCm39) utr 3 prime probably benign
IGL01380:Lrpprc APN 17 85,030,158 (GRCm39) missense probably benign
IGL01560:Lrpprc APN 17 85,015,547 (GRCm39) missense probably benign 0.07
IGL01582:Lrpprc APN 17 85,061,971 (GRCm39) missense probably null 0.00
IGL01996:Lrpprc APN 17 85,080,698 (GRCm39) missense probably benign
IGL02109:Lrpprc APN 17 85,033,998 (GRCm39) nonsense probably null
IGL02163:Lrpprc APN 17 85,060,900 (GRCm39) missense probably damaging 0.97
IGL02248:Lrpprc APN 17 85,078,895 (GRCm39) missense probably damaging 0.99
IGL02503:Lrpprc APN 17 85,033,767 (GRCm39) missense probably benign
IGL02545:Lrpprc APN 17 85,082,853 (GRCm39) missense probably benign
IGL02570:Lrpprc APN 17 85,057,981 (GRCm39) missense probably damaging 1.00
IGL02636:Lrpprc APN 17 85,060,532 (GRCm39) unclassified probably benign
IGL02943:Lrpprc APN 17 85,078,878 (GRCm39) missense probably benign 0.00
IGL03008:Lrpprc APN 17 85,058,675 (GRCm39) missense probably benign 0.05
elusory UTSW 17 85,020,215 (GRCm39) missense probably benign 0.01
phantom UTSW 17 85,079,575 (GRCm39) missense probably damaging 1.00
R6807_Lrpprc_629 UTSW 17 85,056,531 (GRCm39) missense possibly damaging 0.93
Stereotype UTSW 17 85,074,483 (GRCm39) missense probably damaging 1.00
thus UTSW 17 85,078,355 (GRCm39) missense probably benign 0.01
P0023:Lrpprc UTSW 17 85,033,766 (GRCm39) missense probably benign 0.00
R0027:Lrpprc UTSW 17 85,074,435 (GRCm39) nonsense probably null
R0027:Lrpprc UTSW 17 85,074,435 (GRCm39) nonsense probably null
R0302:Lrpprc UTSW 17 85,047,506 (GRCm39) missense possibly damaging 0.76
R0389:Lrpprc UTSW 17 85,060,540 (GRCm39) critical splice donor site probably null
R0448:Lrpprc UTSW 17 85,078,322 (GRCm39) missense probably benign 0.09
R1396:Lrpprc UTSW 17 85,033,731 (GRCm39) missense possibly damaging 0.68
R1759:Lrpprc UTSW 17 85,047,509 (GRCm39) missense probably damaging 1.00
R2169:Lrpprc UTSW 17 85,077,505 (GRCm39) missense probably benign 0.00
R2312:Lrpprc UTSW 17 85,080,686 (GRCm39) missense probably damaging 0.96
R2319:Lrpprc UTSW 17 85,033,818 (GRCm39) missense probably benign
R2568:Lrpprc UTSW 17 85,034,077 (GRCm39) missense probably damaging 1.00
R3013:Lrpprc UTSW 17 85,074,497 (GRCm39) missense probably benign 0.04
R3620:Lrpprc UTSW 17 85,077,452 (GRCm39) missense probably benign 0.01
R3789:Lrpprc UTSW 17 85,078,956 (GRCm39) missense probably benign 0.25
R3848:Lrpprc UTSW 17 85,078,355 (GRCm39) missense probably benign 0.01
R3973:Lrpprc UTSW 17 85,078,269 (GRCm39) critical splice donor site probably null
R4111:Lrpprc UTSW 17 85,033,766 (GRCm39) missense probably benign 0.00
R4164:Lrpprc UTSW 17 85,038,617 (GRCm39) missense possibly damaging 0.47
R4331:Lrpprc UTSW 17 85,047,970 (GRCm39) critical splice donor site probably null
R4531:Lrpprc UTSW 17 85,020,215 (GRCm39) missense probably benign 0.01
R4832:Lrpprc UTSW 17 85,014,584 (GRCm39) missense probably benign 0.24
R4947:Lrpprc UTSW 17 85,078,966 (GRCm39) missense probably benign 0.02
R5134:Lrpprc UTSW 17 85,058,684 (GRCm39) missense probably benign 0.00
R5333:Lrpprc UTSW 17 85,097,821 (GRCm39) missense probably benign 0.01
R5950:Lrpprc UTSW 17 85,047,598 (GRCm39) missense possibly damaging 0.86
R5972:Lrpprc UTSW 17 85,020,250 (GRCm39) missense possibly damaging 0.88
R6185:Lrpprc UTSW 17 85,074,452 (GRCm39) missense probably benign
R6253:Lrpprc UTSW 17 85,048,065 (GRCm39) missense probably benign 0.00
R6488:Lrpprc UTSW 17 85,058,781 (GRCm39) missense probably damaging 1.00
R6807:Lrpprc UTSW 17 85,056,531 (GRCm39) missense possibly damaging 0.93
R6911:Lrpprc UTSW 17 85,063,711 (GRCm39) missense possibly damaging 0.67
R6933:Lrpprc UTSW 17 85,030,131 (GRCm39) missense probably benign 0.42
R6955:Lrpprc UTSW 17 85,084,417 (GRCm39) missense probably damaging 0.98
R7448:Lrpprc UTSW 17 85,079,567 (GRCm39) missense probably damaging 0.99
R7727:Lrpprc UTSW 17 85,084,375 (GRCm39) missense probably benign 0.00
R8003:Lrpprc UTSW 17 85,059,745 (GRCm39) missense probably benign 0.01
R8178:Lrpprc UTSW 17 85,079,575 (GRCm39) missense probably damaging 1.00
R8310:Lrpprc UTSW 17 85,080,524 (GRCm39) missense probably damaging 1.00
R8322:Lrpprc UTSW 17 85,047,496 (GRCm39) critical splice donor site probably null
R8389:Lrpprc UTSW 17 85,080,742 (GRCm39) missense possibly damaging 0.79
R8560:Lrpprc UTSW 17 85,047,495 (GRCm39) splice site probably benign
R8777:Lrpprc UTSW 17 85,058,657 (GRCm39) missense probably benign 0.30
R8777-TAIL:Lrpprc UTSW 17 85,058,657 (GRCm39) missense probably benign 0.30
R8868:Lrpprc UTSW 17 85,078,920 (GRCm39) missense probably damaging 0.99
R8970:Lrpprc UTSW 17 85,074,483 (GRCm39) missense probably damaging 1.00
R9042:Lrpprc UTSW 17 85,059,736 (GRCm39) critical splice donor site probably null
R9493:Lrpprc UTSW 17 85,015,548 (GRCm39) missense probably damaging 0.99
R9664:Lrpprc UTSW 17 85,020,262 (GRCm39) missense probably damaging 0.99
X0026:Lrpprc UTSW 17 85,018,090 (GRCm39) missense probably benign 0.42
Z1088:Lrpprc UTSW 17 85,077,928 (GRCm39) critical splice acceptor site probably null
Z1088:Lrpprc UTSW 17 85,039,212 (GRCm39) nonsense probably null
Z1176:Lrpprc UTSW 17 85,077,859 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GGTGTCGCTGAAATTAGTTAGC -3'
(R):5'- CCCTTGGGGCATTTATGACAG -3'

Sequencing Primer
(F):5'- GTCGCTGAAATTAGTTAGCCTTTC -3'
(R):5'- CTTGGGGCATTTATGACAGAGAGAG -3'
Posted On 2014-08-25