Mutagenetix > Incidental Mutation

Incidental Mutation 'R2020:Sag'

223733

Institutional Source

Beutler Lab

Gene Symbol

Sag

Ensembl Gene

ENSMUSG00000056055

Gene Name

S-antigen, retina and pineal gland (arrestin)

Synonyms

arrestin 1, A930001K18Rik, arrestin, visual arrestin 1, Arr1, rod arrestin

MMRRC Submission

040029-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2020 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

87803680-87845158 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 87805315 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 2 (A2T)

Ref Sequence

ENSEMBL: ENSMUSP00000136729 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077772] [ENSMUST00000177757]

AlphaFold

P20443

Predicted Effect

probably damaging
Transcript: ENSMUST00000077772
AA Change: A2T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000076948
Gene: ENSMUSG00000056055
AA Change: A2T

Domain	Start	End	E-Value	Type
Pfam:Arrestin_N	23	181	2.8e-36	PFAM
Arrestin_C	200	361	8.24e-30	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128761

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130886

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155393

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156381

Predicted Effect

probably damaging
Transcript: ENSMUST00000177757
AA Change: A2T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000136729
Gene: ENSMUSG00000056055
AA Change: A2T

Domain	Start	End	E-Value	Type
Pfam:Arrestin_N	23	181	2.7e-34	PFAM
Arrestin_C	200	361	8.24e-30	SMART

Meta Mutation Damage Score

0.0969

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 93.6%

Validation Efficiency

99% (87/88)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of arrestin/beta-arrestin protein family are thought to participate in agonist-mediated desensitization of G-protein-coupled receptors and cause specific dampening of cellular responses to stimuli such as hormones, neurotransmitters, or sensory signals. S-arrestin, also known as S-antigen, is a major soluble photoreceptor protein that is involved in desensitization of the photoactivated transduction cascade. It is expressed in the retina and the pineal gland and inhibits coupling of rhodopsin to transducin in vitro. Additionally, S-arrestin is highly antigenic, and is capable of inducing experimental autoimmune uveoretinitis. Mutations in this gene have been associated with Oguchi disease, a rare autosomal recessive form of night blindness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormalities in retinal rod cell outer segment morphology and rod electrophysiology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600012P17Rik	C	A	1: 158,968,912		noncoding transcript	Het
9530053A07Rik	T	C	7: 28,155,594	S1882P	probably benign	Het
Adam17	G	A	12: 21,349,875	R177C	probably damaging	Het
Ak7	G	A	12: 105,745,332		probably null	Het
Akap9	T	C	5: 3,961,967	V890A	probably damaging	Het
Alg6	A	G	4: 99,738,132	N59S	probably damaging	Het
Alkbh5	G	T	11: 60,538,549	A43S	probably benign	Het
Anxa2	C	A	9: 69,483,817	D162E	probably damaging	Het
Arap1	A	G	7: 101,401,518	H1136R	probably benign	Het
Arhgap18	A	G	10: 26,854,904	R121G	probably benign	Het
Arhgef4	A	T	1: 34,723,810	T716S	unknown	Het
Atg2a	T	C	19: 6,250,269		probably null	Het
Ccdc27	T	C	4: 154,033,313	I480V	probably null	Het
Cdipt	T	C	7: 126,976,933	V20A	possibly damaging	Het
Cgrrf1	C	T	14: 46,830,445		probably benign	Het
Chd7	G	A	4: 8,855,226	V2152I	probably benign	Het
Chd8	T	A	14: 52,215,241	S1274C	probably damaging	Het
Chuk	A	T	19: 44,107,343	M17K	possibly damaging	Het
Col14a1	C	T	15: 55,446,181		probably benign	Het
Col20a1	G	A	2: 181,013,163		probably null	Het
Cped1	A	G	6: 22,143,964	I570V	probably benign	Het
Cul9	C	G	17: 46,522,175	A1326P	probably damaging	Het
Ddx27	A	C	2: 167,033,771	Q674P	probably damaging	Het
Dennd6a	T	A	14: 26,612,003	F131L	probably damaging	Het
Dhx38	G	A	8: 109,556,869		probably benign	Het
Dido1	G	T	2: 180,659,585	N2175K	unknown	Het
Dmxl1	T	A	18: 49,889,558	Y1654*	probably null	Het
Dock7	T	A	4: 98,959,101	H1658L	probably damaging	Het
Dync2h1	T	A	9: 7,122,772	E2061D	probably damaging	Het
Dync2h1	T	C	9: 7,162,925	I555V	probably benign	Het
Eif2ak2	T	C	17: 78,863,963	E337G	possibly damaging	Het
Fabp12	T	A	3: 10,250,149	D46V	probably benign	Het
Fech	C	T	18: 64,478,727	E79K	probably damaging	Het
Flnc	A	T	6: 29,444,363	I693F	probably damaging	Het
Foxp2	G	A	6: 15,324,644	C97Y	possibly damaging	Het
Grin2b	A	G	6: 135,733,896	M884T	probably benign	Het
Gtf2ird1	T	C	5: 134,417,093	D28G	probably damaging	Het
Gtf3c4	C	A	2: 28,833,894	G468W	possibly damaging	Het
Ift172	A	T	5: 31,267,241	L201*	probably null	Het
Il1rl2	C	A	1: 40,365,214	S498R	probably damaging	Het
Ildr1	C	T	16: 36,725,541	R489W	probably damaging	Het
Itga10	G	A	3: 96,652,490	G487D	probably damaging	Het
Klk8	A	G	7: 43,799,216	N128D	probably benign	Het
Lgr6	G	A	1: 135,075,275	T79M	probably damaging	Het
Med6	T	C	12: 81,573,877	T232A	probably benign	Het
Mgat4e	A	G	1: 134,541,322	L328P	probably damaging	Het
Mttp	A	G	3: 138,118,402	Y138H	probably damaging	Het
Ngef	T	C	1: 87,545,968	R31G	probably benign	Het
Nipsnap2	C	A	5: 129,753,223		probably null	Het
Nlgn2	G	T	11: 69,828,441	N194K	probably damaging	Het
Olfr1026	A	G	2: 85,923,743	I158M	probably benign	Het
Olfr1245	A	T	2: 89,574,961	M255K	possibly damaging	Het
Olfr1450	G	A	19: 12,954,332	V248I	possibly damaging	Het
Olfr357	G	A	2: 36,997,652	V281M	possibly damaging	Het
Olfr894	A	G	9: 38,219,432	Y203C	possibly damaging	Het
Pcca	T	A	14: 122,813,222	M101K	possibly damaging	Het
Plekha6	A	G	1: 133,284,970	T671A	possibly damaging	Het
Prex2	G	A	1: 11,162,312	V868M	probably damaging	Het
Prkcq	G	A	2: 11,279,521	V501I	probably benign	Het
Prom1	T	A	5: 44,011,253		probably benign	Het
Ptprd	A	G	4: 76,133,161	V41A	probably damaging	Het
Rab39	C	T	9: 53,686,398	G189E	possibly damaging	Het
Ret	T	C	6: 118,180,382	K236E	possibly damaging	Het
Rfx6	G	A	10: 51,720,057		probably null	Het
Rnf213	A	G	11: 119,461,918	T3916A	probably damaging	Het
Rpn1	A	G	6: 88,095,683	N336S	probably damaging	Het
Sco2	T	C	15: 89,371,860	Y197C	probably damaging	Het
Sec23b	T	C	2: 144,566,944	I183T	possibly damaging	Het
Sec24b	C	T	3: 129,987,728	V1166M	probably damaging	Het
Slc27a5	A	T	7: 12,993,412	F361Y	probably damaging	Het
Spaca9	A	G	2: 28,696,001	L17P	probably damaging	Het
Sqor	T	C	2: 122,804,107		probably null	Het
Stx18	A	G	5: 38,135,244	H230R	probably damaging	Het
Tas2r130	A	T	6: 131,630,769	I21N	probably damaging	Het
Tcaf3	A	G	6: 42,593,724	S365P	possibly damaging	Het
Tinagl1	G	A	4: 130,166,972	H351Y	probably damaging	Het
Tmc2	T	C	2: 130,232,385	Y333H	probably damaging	Het
Trp53bp2	A	T	1: 182,442,819	T395S	probably damaging	Het
Tsc22d1	T	C	14: 76,418,333	S751P	probably damaging	Het
Ttc30a1	A	G	2: 75,980,935	V268A	probably benign	Het
Ttn	A	G	2: 76,827,024		probably benign	Het
Ugdh	T	C	5: 65,416,925	Y425C	probably damaging	Het
Vmn1r115	G	A	7: 20,844,169	L273F	probably null	Het
Vmn2r109	A	T	17: 20,541,186	C636*	probably null	Het
Vmn2r59	A	C	7: 42,043,779	Y466D	probably damaging	Het
Zic5	C	T	14: 122,464,830	G163D	unknown	Het

Other mutations in Sag

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00684:Sag	APN	1	87824424	critical splice acceptor site	probably null
IGL00822:Sag	APN	1	87845026	splice site	probably null
IGL01140:Sag	APN	1	87823364	missense	probably benign	0.22
IGL01612:Sag	APN	1	87805349	missense	probably damaging	0.98
IGL02183:Sag	APN	1	87828475	splice site	probably null
IGL02893:Sag	APN	1	87834593	missense	probably benign	0.01
R0049:Sag	UTSW	1	87834618	missense	probably damaging	0.99
R0049:Sag	UTSW	1	87834618	missense	probably damaging	0.99
R0091:Sag	UTSW	1	87814680	missense	probably damaging	0.96
R0531:Sag	UTSW	1	87834629	critical splice donor site	probably null
R0609:Sag	UTSW	1	87812991	missense	probably damaging	0.98
R1328:Sag	UTSW	1	87810294	splice site	probably benign
R1395:Sag	UTSW	1	87828441	missense	probably benign	0.01
R1748:Sag	UTSW	1	87831940	missense	probably damaging	1.00
R1858:Sag	UTSW	1	87814848	missense	probably benign
R3854:Sag	UTSW	1	87824518	splice site	probably benign
R4021:Sag	UTSW	1	87821305	critical splice acceptor site	probably null
R4298:Sag	UTSW	1	87845015	missense	probably benign
R4630:Sag	UTSW	1	87834618	missense	probably damaging	0.99
R5352:Sag	UTSW	1	87812993	missense	probably benign	0.01
R5680:Sag	UTSW	1	87821337	missense	possibly damaging	0.83
R6164:Sag	UTSW	1	87824453	missense	probably damaging	1.00
R6407:Sag	UTSW	1	87814806	missense	probably benign
R7431:Sag	UTSW	1	87821337	missense	possibly damaging	0.83
R7548:Sag	UTSW	1	87844916	missense	probably benign	0.01
R8122:Sag	UTSW	1	87834567	missense	probably damaging	1.00
R8679:Sag	UTSW	1	87810310	missense	probably benign	0.27
R8723:Sag	UTSW	1	87823453	critical splice donor site	probably null
R8878:Sag	UTSW	1	87828436	missense	probably benign	0.01
R8891:Sag	UTSW	1	87831961	missense	probably damaging	1.00
R8995:Sag	UTSW	1	87805330	missense	probably benign	0.00
R9036:Sag	UTSW	1	87821332	missense	probably damaging	1.00
R9123:Sag	UTSW	1	87823321	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTGATCAGTGCTGGTTTGATC -3'
(R):5'- TGCAGGATCCACTGTTGTTC -3'

Sequencing Primer
(F):5'- TTGATCATGGATGGATACTGGAAC -3'
(R):5'- TGGACACCAGCCTTCCCTAG -3'

Posted On

2014-08-25