Incidental Mutation 'R2020:Sag'
ID 223733
Institutional Source Beutler Lab
Gene Symbol Sag
Ensembl Gene ENSMUSG00000056055
Gene Name S-antigen, retina and pineal gland (arrestin)
Synonyms arrestin 1, A930001K18Rik, arrestin, visual arrestin 1, Arr1, rod arrestin
MMRRC Submission 040029-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2020 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 87803680-87845158 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 87805315 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 2 (A2T)
Ref Sequence ENSEMBL: ENSMUSP00000136729 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077772] [ENSMUST00000177757]
AlphaFold P20443
Predicted Effect probably damaging
Transcript: ENSMUST00000077772
AA Change: A2T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076948
Gene: ENSMUSG00000056055
AA Change: A2T

DomainStartEndE-ValueType
Pfam:Arrestin_N 23 181 2.8e-36 PFAM
Arrestin_C 200 361 8.24e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128761
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130886
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155393
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156381
Predicted Effect probably damaging
Transcript: ENSMUST00000177757
AA Change: A2T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136729
Gene: ENSMUSG00000056055
AA Change: A2T

DomainStartEndE-ValueType
Pfam:Arrestin_N 23 181 2.7e-34 PFAM
Arrestin_C 200 361 8.24e-30 SMART
Meta Mutation Damage Score 0.0969 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.6%
Validation Efficiency 99% (87/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of arrestin/beta-arrestin protein family are thought to participate in agonist-mediated desensitization of G-protein-coupled receptors and cause specific dampening of cellular responses to stimuli such as hormones, neurotransmitters, or sensory signals. S-arrestin, also known as S-antigen, is a major soluble photoreceptor protein that is involved in desensitization of the photoactivated transduction cascade. It is expressed in the retina and the pineal gland and inhibits coupling of rhodopsin to transducin in vitro. Additionally, S-arrestin is highly antigenic, and is capable of inducing experimental autoimmune uveoretinitis. Mutations in this gene have been associated with Oguchi disease, a rare autosomal recessive form of night blindness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormalities in retinal rod cell outer segment morphology and rod electrophysiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012P17Rik C A 1: 158,968,912 noncoding transcript Het
9530053A07Rik T C 7: 28,155,594 S1882P probably benign Het
Adam17 G A 12: 21,349,875 R177C probably damaging Het
Ak7 G A 12: 105,745,332 probably null Het
Akap9 T C 5: 3,961,967 V890A probably damaging Het
Alg6 A G 4: 99,738,132 N59S probably damaging Het
Alkbh5 G T 11: 60,538,549 A43S probably benign Het
Anxa2 C A 9: 69,483,817 D162E probably damaging Het
Arap1 A G 7: 101,401,518 H1136R probably benign Het
Arhgap18 A G 10: 26,854,904 R121G probably benign Het
Arhgef4 A T 1: 34,723,810 T716S unknown Het
Atg2a T C 19: 6,250,269 probably null Het
Ccdc27 T C 4: 154,033,313 I480V probably null Het
Cdipt T C 7: 126,976,933 V20A possibly damaging Het
Cgrrf1 C T 14: 46,830,445 probably benign Het
Chd7 G A 4: 8,855,226 V2152I probably benign Het
Chd8 T A 14: 52,215,241 S1274C probably damaging Het
Chuk A T 19: 44,107,343 M17K possibly damaging Het
Col14a1 C T 15: 55,446,181 probably benign Het
Col20a1 G A 2: 181,013,163 probably null Het
Cped1 A G 6: 22,143,964 I570V probably benign Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Ddx27 A C 2: 167,033,771 Q674P probably damaging Het
Dennd6a T A 14: 26,612,003 F131L probably damaging Het
Dhx38 G A 8: 109,556,869 probably benign Het
Dido1 G T 2: 180,659,585 N2175K unknown Het
Dmxl1 T A 18: 49,889,558 Y1654* probably null Het
Dock7 T A 4: 98,959,101 H1658L probably damaging Het
Dync2h1 T A 9: 7,122,772 E2061D probably damaging Het
Dync2h1 T C 9: 7,162,925 I555V probably benign Het
Eif2ak2 T C 17: 78,863,963 E337G possibly damaging Het
Fabp12 T A 3: 10,250,149 D46V probably benign Het
Fech C T 18: 64,478,727 E79K probably damaging Het
Flnc A T 6: 29,444,363 I693F probably damaging Het
Foxp2 G A 6: 15,324,644 C97Y possibly damaging Het
Grin2b A G 6: 135,733,896 M884T probably benign Het
Gtf2ird1 T C 5: 134,417,093 D28G probably damaging Het
Gtf3c4 C A 2: 28,833,894 G468W possibly damaging Het
Ift172 A T 5: 31,267,241 L201* probably null Het
Il1rl2 C A 1: 40,365,214 S498R probably damaging Het
Ildr1 C T 16: 36,725,541 R489W probably damaging Het
Itga10 G A 3: 96,652,490 G487D probably damaging Het
Klk8 A G 7: 43,799,216 N128D probably benign Het
Lgr6 G A 1: 135,075,275 T79M probably damaging Het
Med6 T C 12: 81,573,877 T232A probably benign Het
Mgat4e A G 1: 134,541,322 L328P probably damaging Het
Mttp A G 3: 138,118,402 Y138H probably damaging Het
Ngef T C 1: 87,545,968 R31G probably benign Het
Nipsnap2 C A 5: 129,753,223 probably null Het
Nlgn2 G T 11: 69,828,441 N194K probably damaging Het
Olfr1026 A G 2: 85,923,743 I158M probably benign Het
Olfr1245 A T 2: 89,574,961 M255K possibly damaging Het
Olfr1450 G A 19: 12,954,332 V248I possibly damaging Het
Olfr357 G A 2: 36,997,652 V281M possibly damaging Het
Olfr894 A G 9: 38,219,432 Y203C possibly damaging Het
Pcca T A 14: 122,813,222 M101K possibly damaging Het
Plekha6 A G 1: 133,284,970 T671A possibly damaging Het
Prex2 G A 1: 11,162,312 V868M probably damaging Het
Prkcq G A 2: 11,279,521 V501I probably benign Het
Prom1 T A 5: 44,011,253 probably benign Het
Ptprd A G 4: 76,133,161 V41A probably damaging Het
Rab39 C T 9: 53,686,398 G189E possibly damaging Het
Ret T C 6: 118,180,382 K236E possibly damaging Het
Rfx6 G A 10: 51,720,057 probably null Het
Rnf213 A G 11: 119,461,918 T3916A probably damaging Het
Rpn1 A G 6: 88,095,683 N336S probably damaging Het
Sco2 T C 15: 89,371,860 Y197C probably damaging Het
Sec23b T C 2: 144,566,944 I183T possibly damaging Het
Sec24b C T 3: 129,987,728 V1166M probably damaging Het
Slc27a5 A T 7: 12,993,412 F361Y probably damaging Het
Spaca9 A G 2: 28,696,001 L17P probably damaging Het
Sqor T C 2: 122,804,107 probably null Het
Stx18 A G 5: 38,135,244 H230R probably damaging Het
Tas2r130 A T 6: 131,630,769 I21N probably damaging Het
Tcaf3 A G 6: 42,593,724 S365P possibly damaging Het
Tinagl1 G A 4: 130,166,972 H351Y probably damaging Het
Tmc2 T C 2: 130,232,385 Y333H probably damaging Het
Trp53bp2 A T 1: 182,442,819 T395S probably damaging Het
Tsc22d1 T C 14: 76,418,333 S751P probably damaging Het
Ttc30a1 A G 2: 75,980,935 V268A probably benign Het
Ttn A G 2: 76,827,024 probably benign Het
Ugdh T C 5: 65,416,925 Y425C probably damaging Het
Vmn1r115 G A 7: 20,844,169 L273F probably null Het
Vmn2r109 A T 17: 20,541,186 C636* probably null Het
Vmn2r59 A C 7: 42,043,779 Y466D probably damaging Het
Zic5 C T 14: 122,464,830 G163D unknown Het
Other mutations in Sag
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00684:Sag APN 1 87824424 critical splice acceptor site probably null
IGL00822:Sag APN 1 87845026 splice site probably null
IGL01140:Sag APN 1 87823364 missense probably benign 0.22
IGL01612:Sag APN 1 87805349 missense probably damaging 0.98
IGL02183:Sag APN 1 87828475 splice site probably null
IGL02893:Sag APN 1 87834593 missense probably benign 0.01
R0049:Sag UTSW 1 87834618 missense probably damaging 0.99
R0049:Sag UTSW 1 87834618 missense probably damaging 0.99
R0091:Sag UTSW 1 87814680 missense probably damaging 0.96
R0531:Sag UTSW 1 87834629 critical splice donor site probably null
R0609:Sag UTSW 1 87812991 missense probably damaging 0.98
R1328:Sag UTSW 1 87810294 splice site probably benign
R1395:Sag UTSW 1 87828441 missense probably benign 0.01
R1748:Sag UTSW 1 87831940 missense probably damaging 1.00
R1858:Sag UTSW 1 87814848 missense probably benign
R3854:Sag UTSW 1 87824518 splice site probably benign
R4021:Sag UTSW 1 87821305 critical splice acceptor site probably null
R4298:Sag UTSW 1 87845015 missense probably benign
R4630:Sag UTSW 1 87834618 missense probably damaging 0.99
R5352:Sag UTSW 1 87812993 missense probably benign 0.01
R5680:Sag UTSW 1 87821337 missense possibly damaging 0.83
R6164:Sag UTSW 1 87824453 missense probably damaging 1.00
R6407:Sag UTSW 1 87814806 missense probably benign
R7431:Sag UTSW 1 87821337 missense possibly damaging 0.83
R7548:Sag UTSW 1 87844916 missense probably benign 0.01
R8122:Sag UTSW 1 87834567 missense probably damaging 1.00
R8679:Sag UTSW 1 87810310 missense probably benign 0.27
R8723:Sag UTSW 1 87823453 critical splice donor site probably null
R8878:Sag UTSW 1 87828436 missense probably benign 0.01
R8891:Sag UTSW 1 87831961 missense probably damaging 1.00
R8995:Sag UTSW 1 87805330 missense probably benign 0.00
R9036:Sag UTSW 1 87821332 missense probably damaging 1.00
R9123:Sag UTSW 1 87823321 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGATCAGTGCTGGTTTGATC -3'
(R):5'- TGCAGGATCCACTGTTGTTC -3'

Sequencing Primer
(F):5'- TTGATCATGGATGGATACTGGAAC -3'
(R):5'- TGGACACCAGCCTTCCCTAG -3'
Posted On 2014-08-25