Incidental Mutation 'R2020:Lgr6'
ID 223739
Institutional Source Beutler Lab
Gene Symbol Lgr6
Ensembl Gene ENSMUSG00000042793
Gene Name leucine-rich repeat-containing G protein-coupled receptor 6
Synonyms A530037C04Rik
MMRRC Submission 040029-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2020 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 134983301-135105276 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 135075275 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 79 (T79M)
Ref Sequence ENSEMBL: ENSMUSP00000035444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044828]
AlphaFold Q3UVD5
Predicted Effect probably damaging
Transcript: ENSMUST00000044828
AA Change: T79M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000035444
Gene: ENSMUSG00000042793
AA Change: T79M

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
LRRNT 34 70 5.19e-3 SMART
LRR 64 88 1.03e1 SMART
LRR_TYP 89 112 6.52e-5 SMART
LRR_TYP 113 136 2.71e-2 SMART
LRR_TYP 137 160 4.79e-3 SMART
LRR_TYP 161 184 1.58e-3 SMART
LRR_TYP 185 208 2.36e-2 SMART
LRR_TYP 209 232 3.39e-3 SMART
LRR 233 255 8.97e0 SMART
LRR_TYP 256 279 1.36e-2 SMART
Blast:LRR 281 303 6e-7 BLAST
LRR 327 350 9.24e1 SMART
LRR 351 373 1.41e0 SMART
LRR 374 396 4.84e1 SMART
LRR_TYP 397 420 4.54e-4 SMART
LRR_TYP 421 444 7.15e-2 SMART
transmembrane domain 568 590 N/A INTRINSIC
transmembrane domain 599 621 N/A INTRINSIC
transmembrane domain 643 665 N/A INTRINSIC
transmembrane domain 686 708 N/A INTRINSIC
transmembrane domain 728 750 N/A INTRINSIC
transmembrane domain 776 798 N/A INTRINSIC
transmembrane domain 808 830 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.6%
Validation Efficiency 99% (87/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the leucine-rich repeat-containing subgroup of the G protein-coupled 7-transmembrane protein superfamily. The encoded protein is a glycoprotein hormone receptor with a large N-terminal extracellular domain that contains leucine-rich repeats important for the formation of a horseshoe-shaped interaction motif for ligand binding. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter/null allele are viable and fertile with no apparent abnormal phenotype. Similarly, mice homozygous for a knock-in allele are healthy and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012P17Rik C A 1: 158,968,912 noncoding transcript Het
9530053A07Rik T C 7: 28,155,594 S1882P probably benign Het
Adam17 G A 12: 21,349,875 R177C probably damaging Het
Ak7 G A 12: 105,745,332 probably null Het
Akap9 T C 5: 3,961,967 V890A probably damaging Het
Alg6 A G 4: 99,738,132 N59S probably damaging Het
Alkbh5 G T 11: 60,538,549 A43S probably benign Het
Anxa2 C A 9: 69,483,817 D162E probably damaging Het
Arap1 A G 7: 101,401,518 H1136R probably benign Het
Arhgap18 A G 10: 26,854,904 R121G probably benign Het
Arhgef4 A T 1: 34,723,810 T716S unknown Het
Atg2a T C 19: 6,250,269 probably null Het
Ccdc27 T C 4: 154,033,313 I480V probably null Het
Cdipt T C 7: 126,976,933 V20A possibly damaging Het
Cgrrf1 C T 14: 46,830,445 probably benign Het
Chd7 G A 4: 8,855,226 V2152I probably benign Het
Chd8 T A 14: 52,215,241 S1274C probably damaging Het
Chuk A T 19: 44,107,343 M17K possibly damaging Het
Col14a1 C T 15: 55,446,181 probably benign Het
Col20a1 G A 2: 181,013,163 probably null Het
Cped1 A G 6: 22,143,964 I570V probably benign Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Ddx27 A C 2: 167,033,771 Q674P probably damaging Het
Dennd6a T A 14: 26,612,003 F131L probably damaging Het
Dhx38 G A 8: 109,556,869 probably benign Het
Dido1 G T 2: 180,659,585 N2175K unknown Het
Dmxl1 T A 18: 49,889,558 Y1654* probably null Het
Dock7 T A 4: 98,959,101 H1658L probably damaging Het
Dync2h1 T C 9: 7,162,925 I555V probably benign Het
Dync2h1 T A 9: 7,122,772 E2061D probably damaging Het
Eif2ak2 T C 17: 78,863,963 E337G possibly damaging Het
Fabp12 T A 3: 10,250,149 D46V probably benign Het
Fech C T 18: 64,478,727 E79K probably damaging Het
Flnc A T 6: 29,444,363 I693F probably damaging Het
Foxp2 G A 6: 15,324,644 C97Y possibly damaging Het
Grin2b A G 6: 135,733,896 M884T probably benign Het
Gtf2ird1 T C 5: 134,417,093 D28G probably damaging Het
Gtf3c4 C A 2: 28,833,894 G468W possibly damaging Het
Ift172 A T 5: 31,267,241 L201* probably null Het
Il1rl2 C A 1: 40,365,214 S498R probably damaging Het
Ildr1 C T 16: 36,725,541 R489W probably damaging Het
Itga10 G A 3: 96,652,490 G487D probably damaging Het
Klk8 A G 7: 43,799,216 N128D probably benign Het
Med6 T C 12: 81,573,877 T232A probably benign Het
Mgat4e A G 1: 134,541,322 L328P probably damaging Het
Mttp A G 3: 138,118,402 Y138H probably damaging Het
Ngef T C 1: 87,545,968 R31G probably benign Het
Nipsnap2 C A 5: 129,753,223 probably null Het
Nlgn2 G T 11: 69,828,441 N194K probably damaging Het
Olfr1026 A G 2: 85,923,743 I158M probably benign Het
Olfr1245 A T 2: 89,574,961 M255K possibly damaging Het
Olfr1450 G A 19: 12,954,332 V248I possibly damaging Het
Olfr357 G A 2: 36,997,652 V281M possibly damaging Het
Olfr894 A G 9: 38,219,432 Y203C possibly damaging Het
Pcca T A 14: 122,813,222 M101K possibly damaging Het
Plekha6 A G 1: 133,284,970 T671A possibly damaging Het
Prex2 G A 1: 11,162,312 V868M probably damaging Het
Prkcq G A 2: 11,279,521 V501I probably benign Het
Prom1 T A 5: 44,011,253 probably benign Het
Ptprd A G 4: 76,133,161 V41A probably damaging Het
Rab39 C T 9: 53,686,398 G189E possibly damaging Het
Ret T C 6: 118,180,382 K236E possibly damaging Het
Rfx6 G A 10: 51,720,057 probably null Het
Rnf213 A G 11: 119,461,918 T3916A probably damaging Het
Rpn1 A G 6: 88,095,683 N336S probably damaging Het
Sag G A 1: 87,805,315 A2T probably damaging Het
Sco2 T C 15: 89,371,860 Y197C probably damaging Het
Sec23b T C 2: 144,566,944 I183T possibly damaging Het
Sec24b C T 3: 129,987,728 V1166M probably damaging Het
Slc27a5 A T 7: 12,993,412 F361Y probably damaging Het
Spaca9 A G 2: 28,696,001 L17P probably damaging Het
Sqor T C 2: 122,804,107 probably null Het
Stx18 A G 5: 38,135,244 H230R probably damaging Het
Tas2r130 A T 6: 131,630,769 I21N probably damaging Het
Tcaf3 A G 6: 42,593,724 S365P possibly damaging Het
Tinagl1 G A 4: 130,166,972 H351Y probably damaging Het
Tmc2 T C 2: 130,232,385 Y333H probably damaging Het
Trp53bp2 A T 1: 182,442,819 T395S probably damaging Het
Tsc22d1 T C 14: 76,418,333 S751P probably damaging Het
Ttc30a1 A G 2: 75,980,935 V268A probably benign Het
Ttn A G 2: 76,827,024 probably benign Het
Ugdh T C 5: 65,416,925 Y425C probably damaging Het
Vmn1r115 G A 7: 20,844,169 L273F probably null Het
Vmn2r109 A T 17: 20,541,186 C636* probably null Het
Vmn2r59 A C 7: 42,043,779 Y466D probably damaging Het
Zic5 C T 14: 122,464,830 G163D unknown Het
Other mutations in Lgr6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02481:Lgr6 APN 1 135001691 splice site probably benign
IGL02483:Lgr6 APN 1 135001691 splice site probably benign
IGL03270:Lgr6 APN 1 134997704 missense probably damaging 1.00
R0002:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0294:Lgr6 UTSW 1 134987891 missense probably damaging 0.99
R0294:Lgr6 UTSW 1 135105061 missense unknown
R0361:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0390:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0731:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0734:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0741:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0742:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0765:Lgr6 UTSW 1 134993886 missense probably benign 0.04
R0903:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0904:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0905:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0906:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0907:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0908:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R0967:Lgr6 UTSW 1 134994012 missense probably damaging 1.00
R1078:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R1079:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R1131:Lgr6 UTSW 1 134987304 missense probably damaging 0.98
R1440:Lgr6 UTSW 1 134987472 missense probably damaging 1.00
R1533:Lgr6 UTSW 1 135104932 missense possibly damaging 0.66
R1728:Lgr6 UTSW 1 134987088 missense probably benign 0.00
R1728:Lgr6 UTSW 1 134990635 missense probably benign 0.18
R1728:Lgr6 UTSW 1 135003476 missense probably benign
R1729:Lgr6 UTSW 1 134987088 missense probably benign 0.00
R1729:Lgr6 UTSW 1 134988009 missense probably benign
R1729:Lgr6 UTSW 1 134990635 missense probably benign 0.18
R1729:Lgr6 UTSW 1 135003476 missense probably benign
R1730:Lgr6 UTSW 1 134987088 missense probably benign 0.00
R1730:Lgr6 UTSW 1 134988009 missense probably benign
R1730:Lgr6 UTSW 1 134990635 missense probably benign 0.18
R1730:Lgr6 UTSW 1 135003476 missense probably benign
R1739:Lgr6 UTSW 1 134987088 missense probably benign 0.00
R1739:Lgr6 UTSW 1 134988009 missense probably benign
R1739:Lgr6 UTSW 1 134990635 missense probably benign 0.18
R1739:Lgr6 UTSW 1 135003476 missense probably benign
R1762:Lgr6 UTSW 1 134987088 missense probably benign 0.00
R1762:Lgr6 UTSW 1 134988009 missense probably benign
R1762:Lgr6 UTSW 1 134990635 missense probably benign 0.18
R1762:Lgr6 UTSW 1 135003476 missense probably benign
R1782:Lgr6 UTSW 1 134987979 missense probably damaging 0.98
R1783:Lgr6 UTSW 1 134987088 missense probably benign 0.00
R1783:Lgr6 UTSW 1 134988009 missense probably benign
R1783:Lgr6 UTSW 1 134990635 missense probably benign 0.18
R1783:Lgr6 UTSW 1 135003476 missense probably benign
R1784:Lgr6 UTSW 1 134987088 missense probably benign 0.00
R1784:Lgr6 UTSW 1 134988009 missense probably benign
R1784:Lgr6 UTSW 1 134990635 missense probably benign 0.18
R1784:Lgr6 UTSW 1 135003476 missense probably benign
R1785:Lgr6 UTSW 1 134987088 missense probably benign 0.00
R1785:Lgr6 UTSW 1 134988009 missense probably benign
R1785:Lgr6 UTSW 1 134990635 missense probably benign 0.18
R1785:Lgr6 UTSW 1 135003476 missense probably benign
R3104:Lgr6 UTSW 1 135000472 splice site probably null
R4629:Lgr6 UTSW 1 135104932 missense probably damaging 0.99
R4792:Lgr6 UTSW 1 135021806 missense probably benign 0.03
R5001:Lgr6 UTSW 1 134990632 missense probably benign 0.01
R5191:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5194:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5195:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5196:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5197:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5228:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5230:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5243:Lgr6 UTSW 1 135109272 unclassified probably benign
R5299:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5300:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5417:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5419:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5601:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5603:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5636:Lgr6 UTSW 1 134987078 missense probably benign 0.28
R5699:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5748:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5767:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5825:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R5971:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6078:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6079:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6138:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6258:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6259:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6260:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6740:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6871:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
R6984:Lgr6 UTSW 1 134988002 missense possibly damaging 0.54
R6986:Lgr6 UTSW 1 134993956 missense possibly damaging 0.80
R7233:Lgr6 UTSW 1 135000476 critical splice donor site probably null
R7699:Lgr6 UTSW 1 134996032 missense probably damaging 1.00
R7700:Lgr6 UTSW 1 134996032 missense probably damaging 1.00
R7734:Lgr6 UTSW 1 135003243 missense probably damaging 1.00
R7849:Lgr6 UTSW 1 134987681 missense probably damaging 1.00
R7970:Lgr6 UTSW 1 134993985 missense probably benign
R8068:Lgr6 UTSW 1 135063664 missense probably benign 0.00
R8252:Lgr6 UTSW 1 135003477 missense probably null 0.78
R8516:Lgr6 UTSW 1 135075283 missense probably damaging 1.00
R8771:Lgr6 UTSW 1 135005691 nonsense probably null
R8858:Lgr6 UTSW 1 134996111 critical splice acceptor site probably null
R8885:Lgr6 UTSW 1 134987604 missense probably benign 0.00
R9014:Lgr6 UTSW 1 135003510 missense probably damaging 1.00
R9277:Lgr6 UTSW 1 134987479 nonsense probably null
R9660:Lgr6 UTSW 1 134987507 missense probably damaging 1.00
R9728:Lgr6 UTSW 1 134987507 missense probably damaging 1.00
Z1088:Lgr6 UTSW 1 134988071 missense possibly damaging 0.89
Z1191:Lgr6 UTSW 1 134994010 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTCCCGAGTGAGCTCTGC -3'
(R):5'- TGTTGCCAGACATCCAGTGG -3'

Sequencing Primer
(F):5'- TCAAGTTCCAGAGAGCCCAGG -3'
(R):5'- ACATCCAGTGGGGTCCAGATG -3'
Posted On 2014-08-25