Mutagenetix > Incidental Mutation

Incidental Mutation 'R2020:Prkcq'

223747

Institutional Source

Beutler Lab

Gene Symbol

Prkcq

Ensembl Gene

ENSMUSG00000026778

Gene Name

protein kinase C, theta

Synonyms

PKC theta, PKC-0, PKCtheta, PKC-theta, A130035A12Rik, Pkcq

MMRRC Submission

040029-MU

Accession Numbers

Genbank: NM_008859; MGI: 97601

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2020 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

11172108-11301222 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 11279521 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 501 (V501I)

Ref Sequence

ENSEMBL: ENSMUSP00000100035 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028118] [ENSMUST00000102970]

AlphaFold

Q02111

Predicted Effect

probably benign
Transcript: ENSMUST00000028118
AA Change: V501I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000028118
Gene: ENSMUSG00000026778
AA Change: V501I

Domain	Start	End	E-Value	Type
PDB:2ENJ\|A	3	126	6e-83	PDB
C1	160	209	3.27e-15	SMART
C1	232	281	2.22e-17	SMART
S_TKc	380	634	1.17e-97	SMART
S_TK_X	635	698	2.6e-26	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000102970
AA Change: V501I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000100035
Gene: ENSMUSG00000026778
AA Change: V501I

Domain	Start	End	E-Value	Type
PDB:2ENJ\|A	3	126	2e-84	PDB
C1	160	209	3.27e-15	SMART
C1	232	281	2.22e-17	SMART
Pfam:Pkinase_Tyr	380	558	2.8e-27	PFAM
Pfam:Pkinase	380	560	2.2e-47	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195207

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195628

Meta Mutation Damage Score

0.0603

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 93.6%

Validation Efficiency

99% (87/88)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role. The protein encoded by this gene is one of the PKC family members. It is a calcium-independent and phospholipid-dependent protein kinase. This kinase is important for T-cell activation. It is required for the activation of the transcription factors NF-kappaB and AP-1, and may link the T cell receptor (TCR) signaling complex to the activation of the transcription factors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced T cell proliferative responses and interleukin 2 production and a lack of T cell receptor-initiated NF-kappaB activation in mature T lymphocytes. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted, knock-out(2) Targeted, other(1)

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600012P17Rik	C	A	1: 158,968,912		noncoding transcript	Het
9530053A07Rik	T	C	7: 28,155,594	S1882P	probably benign	Het
Adam17	G	A	12: 21,349,875	R177C	probably damaging	Het
Ak7	G	A	12: 105,745,332		probably null	Het
Akap9	T	C	5: 3,961,967	V890A	probably damaging	Het
Alg6	A	G	4: 99,738,132	N59S	probably damaging	Het
Alkbh5	G	T	11: 60,538,549	A43S	probably benign	Het
Anxa2	C	A	9: 69,483,817	D162E	probably damaging	Het
Arap1	A	G	7: 101,401,518	H1136R	probably benign	Het
Arhgap18	A	G	10: 26,854,904	R121G	probably benign	Het
Arhgef4	A	T	1: 34,723,810	T716S	unknown	Het
Atg2a	T	C	19: 6,250,269		probably null	Het
Ccdc27	T	C	4: 154,033,313	I480V	probably null	Het
Cdipt	T	C	7: 126,976,933	V20A	possibly damaging	Het
Cgrrf1	C	T	14: 46,830,445		probably benign	Het
Chd7	G	A	4: 8,855,226	V2152I	probably benign	Het
Chd8	T	A	14: 52,215,241	S1274C	probably damaging	Het
Chuk	A	T	19: 44,107,343	M17K	possibly damaging	Het
Col14a1	C	T	15: 55,446,181		probably benign	Het
Col20a1	G	A	2: 181,013,163		probably null	Het
Cped1	A	G	6: 22,143,964	I570V	probably benign	Het
Cul9	C	G	17: 46,522,175	A1326P	probably damaging	Het
Ddx27	A	C	2: 167,033,771	Q674P	probably damaging	Het
Dennd6a	T	A	14: 26,612,003	F131L	probably damaging	Het
Dhx38	G	A	8: 109,556,869		probably benign	Het
Dido1	G	T	2: 180,659,585	N2175K	unknown	Het
Dmxl1	T	A	18: 49,889,558	Y1654*	probably null	Het
Dock7	T	A	4: 98,959,101	H1658L	probably damaging	Het
Dync2h1	T	A	9: 7,122,772	E2061D	probably damaging	Het
Dync2h1	T	C	9: 7,162,925	I555V	probably benign	Het
Eif2ak2	T	C	17: 78,863,963	E337G	possibly damaging	Het
Fabp12	T	A	3: 10,250,149	D46V	probably benign	Het
Fech	C	T	18: 64,478,727	E79K	probably damaging	Het
Flnc	A	T	6: 29,444,363	I693F	probably damaging	Het
Foxp2	G	A	6: 15,324,644	C97Y	possibly damaging	Het
Grin2b	A	G	6: 135,733,896	M884T	probably benign	Het
Gtf2ird1	T	C	5: 134,417,093	D28G	probably damaging	Het
Gtf3c4	C	A	2: 28,833,894	G468W	possibly damaging	Het
Ift172	A	T	5: 31,267,241	L201*	probably null	Het
Il1rl2	C	A	1: 40,365,214	S498R	probably damaging	Het
Ildr1	C	T	16: 36,725,541	R489W	probably damaging	Het
Itga10	G	A	3: 96,652,490	G487D	probably damaging	Het
Klk8	A	G	7: 43,799,216	N128D	probably benign	Het
Lgr6	G	A	1: 135,075,275	T79M	probably damaging	Het
Med6	T	C	12: 81,573,877	T232A	probably benign	Het
Mgat4e	A	G	1: 134,541,322	L328P	probably damaging	Het
Mttp	A	G	3: 138,118,402	Y138H	probably damaging	Het
Ngef	T	C	1: 87,545,968	R31G	probably benign	Het
Nipsnap2	C	A	5: 129,753,223		probably null	Het
Nlgn2	G	T	11: 69,828,441	N194K	probably damaging	Het
Olfr1026	A	G	2: 85,923,743	I158M	probably benign	Het
Olfr1245	A	T	2: 89,574,961	M255K	possibly damaging	Het
Olfr1450	G	A	19: 12,954,332	V248I	possibly damaging	Het
Olfr357	G	A	2: 36,997,652	V281M	possibly damaging	Het
Olfr894	A	G	9: 38,219,432	Y203C	possibly damaging	Het
Pcca	T	A	14: 122,813,222	M101K	possibly damaging	Het
Plekha6	A	G	1: 133,284,970	T671A	possibly damaging	Het
Prex2	G	A	1: 11,162,312	V868M	probably damaging	Het
Prom1	T	A	5: 44,011,253		probably benign	Het
Ptprd	A	G	4: 76,133,161	V41A	probably damaging	Het
Rab39	C	T	9: 53,686,398	G189E	possibly damaging	Het
Ret	T	C	6: 118,180,382	K236E	possibly damaging	Het
Rfx6	G	A	10: 51,720,057		probably null	Het
Rnf213	A	G	11: 119,461,918	T3916A	probably damaging	Het
Rpn1	A	G	6: 88,095,683	N336S	probably damaging	Het
Sag	G	A	1: 87,805,315	A2T	probably damaging	Het
Sco2	T	C	15: 89,371,860	Y197C	probably damaging	Het
Sec23b	T	C	2: 144,566,944	I183T	possibly damaging	Het
Sec24b	C	T	3: 129,987,728	V1166M	probably damaging	Het
Slc27a5	A	T	7: 12,993,412	F361Y	probably damaging	Het
Spaca9	A	G	2: 28,696,001	L17P	probably damaging	Het
Sqor	T	C	2: 122,804,107		probably null	Het
Stx18	A	G	5: 38,135,244	H230R	probably damaging	Het
Tas2r130	A	T	6: 131,630,769	I21N	probably damaging	Het
Tcaf3	A	G	6: 42,593,724	S365P	possibly damaging	Het
Tinagl1	G	A	4: 130,166,972	H351Y	probably damaging	Het
Tmc2	T	C	2: 130,232,385	Y333H	probably damaging	Het
Trp53bp2	A	T	1: 182,442,819	T395S	probably damaging	Het
Tsc22d1	T	C	14: 76,418,333	S751P	probably damaging	Het
Ttc30a1	A	G	2: 75,980,935	V268A	probably benign	Het
Ttn	A	G	2: 76,827,024		probably benign	Het
Ugdh	T	C	5: 65,416,925	Y425C	probably damaging	Het
Vmn1r115	G	A	7: 20,844,169	L273F	probably null	Het
Vmn2r109	A	T	17: 20,541,186	C636*	probably null	Het
Vmn2r59	A	C	7: 42,043,779	Y466D	probably damaging	Het
Zic5	C	T	14: 122,464,830	G163D	unknown	Het

Other mutations in Prkcq

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01654:Prkcq	APN	2	11283843	missense	probably damaging	1.00
IGL01656:Prkcq	APN	2	11226955	missense	probably damaging	1.00
IGL01732:Prkcq	APN	2	11260833	splice site	probably benign
IGL02136:Prkcq	APN	2	11260668	missense	probably benign	0.00
IGL02161:Prkcq	APN	2	11277076	missense	probably benign
IGL02178:Prkcq	APN	2	11277040	missense	possibly damaging	0.93
IGL03107:Prkcq	APN	2	11260786	missense	probably damaging	1.00
IGL03149:Prkcq	APN	2	11232545	missense	probably benign	0.11
banks	UTSW	2	11299410	missense	probably damaging	1.00
celina	UTSW	2	11283849	missense	possibly damaging	0.82
celina2	UTSW	2	11226986	critical splice donor site	probably null
Megabytes	UTSW	2	11290451	nonsense	probably null
Monmouth	UTSW	2	11279524	missense	probably damaging	1.00
3-1:Prkcq	UTSW	2	11300094	missense	probably damaging	1.00
K3955:Prkcq	UTSW	2	11246793	splice site	probably benign
R0049:Prkcq	UTSW	2	11283832	missense	probably benign	0.04
R0049:Prkcq	UTSW	2	11283832	missense	probably benign	0.04
R0183:Prkcq	UTSW	2	11253162	missense	probably damaging	1.00
R0366:Prkcq	UTSW	2	11246838	splice site	probably benign
R0388:Prkcq	UTSW	2	11254234	missense	probably benign
R1385:Prkcq	UTSW	2	11256286	missense	probably damaging	1.00
R1687:Prkcq	UTSW	2	11290533	missense	probably damaging	1.00
R1693:Prkcq	UTSW	2	11254199	missense	probably damaging	0.99
R1760:Prkcq	UTSW	2	11300070	missense	probably damaging	1.00
R1764:Prkcq	UTSW	2	11232631	missense	probably damaging	1.00
R1968:Prkcq	UTSW	2	11245397	missense	probably damaging	1.00
R2108:Prkcq	UTSW	2	11232569	missense	probably damaging	1.00
R2762:Prkcq	UTSW	2	11232640	missense	possibly damaging	0.75
R3402:Prkcq	UTSW	2	11283849	missense	possibly damaging	0.82
R3429:Prkcq	UTSW	2	11246970	missense	probably damaging	1.00
R3545:Prkcq	UTSW	2	11283816	missense	probably benign	0.11
R3547:Prkcq	UTSW	2	11283816	missense	probably benign	0.11
R3893:Prkcq	UTSW	2	11226971	missense	probably damaging	1.00
R4086:Prkcq	UTSW	2	11283868	missense	probably damaging	0.97
R4423:Prkcq	UTSW	2	11256169	missense	possibly damaging	0.66
R4541:Prkcq	UTSW	2	11283812	missense	possibly damaging	0.84
R4649:Prkcq	UTSW	2	11279522	missense	possibly damaging	0.83
R4652:Prkcq	UTSW	2	11279522	missense	possibly damaging	0.83
R4820:Prkcq	UTSW	2	11226986	critical splice donor site	probably null
R5197:Prkcq	UTSW	2	11299416	missense	probably damaging	1.00
R6008:Prkcq	UTSW	2	11256286	missense	probably damaging	1.00
R7030:Prkcq	UTSW	2	11226850	splice site	probably null
R7231:Prkcq	UTSW	2	11290451	nonsense	probably null
R7461:Prkcq	UTSW	2	11299410	missense	probably damaging	1.00
R7613:Prkcq	UTSW	2	11299410	missense	probably damaging	1.00
R8441:Prkcq	UTSW	2	11248226	missense	probably benign	0.11
R8491:Prkcq	UTSW	2	11279524	missense	probably damaging	1.00
R8724:Prkcq	UTSW	2	11299973	missense	probably benign	0.17
R9031:Prkcq	UTSW	2	11247008	missense	probably damaging	0.99
R9164:Prkcq	UTSW	2	11226905	missense	probably damaging	0.96
R9621:Prkcq	UTSW	2	11256203	missense	probably benign	0.00
R9661:Prkcq	UTSW	2	11245330	nonsense	probably null
Z1177:Prkcq	UTSW	2	11299381	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GGGGTTTACTCTGCTGTCCC -3'
(R):5'- GACCCAGAAGCACGAGGTAC -3'

Sequencing Primer
(F):5'- CTGTCCTCATGCTGTGTCTTGG -3'
(R):5'- TAATGTTGTCAGAGATGAATAGTGGC -3'

Posted On

2014-08-25