Incidental Mutation 'R2020:Prkcq'
ID 223747
Institutional Source Beutler Lab
Gene Symbol Prkcq
Ensembl Gene ENSMUSG00000026778
Gene Name protein kinase C, theta
Synonyms A130035A12Rik, PKC-theta, PKC theta, PKC-0, Pkcq, PKCtheta
MMRRC Submission 040029-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2020 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 11176922-11306033 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 11284332 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 501 (V501I)
Ref Sequence ENSEMBL: ENSMUSP00000100035 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028118] [ENSMUST00000102970]
AlphaFold Q02111
Predicted Effect probably benign
Transcript: ENSMUST00000028118
AA Change: V501I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028118
Gene: ENSMUSG00000026778
AA Change: V501I

DomainStartEndE-ValueType
PDB:2ENJ|A 3 126 6e-83 PDB
C1 160 209 3.27e-15 SMART
C1 232 281 2.22e-17 SMART
S_TKc 380 634 1.17e-97 SMART
S_TK_X 635 698 2.6e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102970
AA Change: V501I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000100035
Gene: ENSMUSG00000026778
AA Change: V501I

DomainStartEndE-ValueType
PDB:2ENJ|A 3 126 2e-84 PDB
C1 160 209 3.27e-15 SMART
C1 232 281 2.22e-17 SMART
Pfam:Pkinase_Tyr 380 558 2.8e-27 PFAM
Pfam:Pkinase 380 560 2.2e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195207
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195628
Meta Mutation Damage Score 0.0603 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.6%
Validation Efficiency 99% (87/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role. The protein encoded by this gene is one of the PKC family members. It is a calcium-independent and phospholipid-dependent protein kinase. This kinase is important for T-cell activation. It is required for the activation of the transcription factors NF-kappaB and AP-1, and may link the T cell receptor (TCR) signaling complex to the activation of the transcription factors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced T cell proliferative responses and interleukin 2 production and a lack of T cell receptor-initiated NF-kappaB activation in mature T lymphocytes. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(2) Targeted, other(1)

Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012P17Rik C A 1: 158,796,482 (GRCm39) noncoding transcript Het
Adam17 G A 12: 21,399,876 (GRCm39) R177C probably damaging Het
Ak7 G A 12: 105,711,591 (GRCm39) probably null Het
Akap9 T C 5: 4,011,967 (GRCm39) V890A probably damaging Het
Alg6 A G 4: 99,626,369 (GRCm39) N59S probably damaging Het
Alkbh5 G T 11: 60,429,375 (GRCm39) A43S probably benign Het
Anxa2 C A 9: 69,391,099 (GRCm39) D162E probably damaging Het
Arap1 A G 7: 101,050,725 (GRCm39) H1136R probably benign Het
Arhgap18 A G 10: 26,730,900 (GRCm39) R121G probably benign Het
Arhgef4 A T 1: 34,762,891 (GRCm39) T716S unknown Het
Atg2a T C 19: 6,300,299 (GRCm39) probably null Het
Ccdc27 T C 4: 154,117,770 (GRCm39) I480V probably null Het
Cdipt T C 7: 126,576,105 (GRCm39) V20A possibly damaging Het
Cgrrf1 C T 14: 47,067,902 (GRCm39) probably benign Het
Chd7 G A 4: 8,855,226 (GRCm39) V2152I probably benign Het
Chd8 T A 14: 52,452,698 (GRCm39) S1274C probably damaging Het
Chuk A T 19: 44,095,782 (GRCm39) M17K possibly damaging Het
Col14a1 C T 15: 55,309,577 (GRCm39) probably benign Het
Col20a1 G A 2: 180,654,956 (GRCm39) probably null Het
Cped1 A G 6: 22,143,963 (GRCm39) I570V probably benign Het
Cul9 C G 17: 46,833,101 (GRCm39) A1326P probably damaging Het
Ddx27 A C 2: 166,875,691 (GRCm39) Q674P probably damaging Het
Dennd6a T A 14: 26,333,158 (GRCm39) F131L probably damaging Het
Dhx38 G A 8: 110,283,501 (GRCm39) probably benign Het
Dido1 G T 2: 180,301,378 (GRCm39) N2175K unknown Het
Dmxl1 T A 18: 50,022,625 (GRCm39) Y1654* probably null Het
Dock7 T A 4: 98,847,338 (GRCm39) H1658L probably damaging Het
Dync2h1 T A 9: 7,122,772 (GRCm39) E2061D probably damaging Het
Dync2h1 T C 9: 7,162,925 (GRCm39) I555V probably benign Het
Eif2ak2 T C 17: 79,171,392 (GRCm39) E337G possibly damaging Het
Fabp12 T A 3: 10,315,209 (GRCm39) D46V probably benign Het
Fcgbpl1 T C 7: 27,855,019 (GRCm39) S1882P probably benign Het
Fech C T 18: 64,611,798 (GRCm39) E79K probably damaging Het
Flnc A T 6: 29,444,362 (GRCm39) I693F probably damaging Het
Foxp2 G A 6: 15,324,643 (GRCm39) C97Y possibly damaging Het
Grin2b A G 6: 135,710,894 (GRCm39) M884T probably benign Het
Gtf2ird1 T C 5: 134,445,947 (GRCm39) D28G probably damaging Het
Gtf3c4 C A 2: 28,723,906 (GRCm39) G468W possibly damaging Het
Ift172 A T 5: 31,424,585 (GRCm39) L201* probably null Het
Ift70a1 A G 2: 75,811,279 (GRCm39) V268A probably benign Het
Il1rl2 C A 1: 40,404,374 (GRCm39) S498R probably damaging Het
Ildr1 C T 16: 36,545,903 (GRCm39) R489W probably damaging Het
Itga10 G A 3: 96,559,806 (GRCm39) G487D probably damaging Het
Klk1b8 A G 7: 43,448,640 (GRCm39) N128D probably benign Het
Lgr6 G A 1: 135,003,013 (GRCm39) T79M probably damaging Het
Med6 T C 12: 81,620,651 (GRCm39) T232A probably benign Het
Mgat4e A G 1: 134,469,060 (GRCm39) L328P probably damaging Het
Mttp A G 3: 137,824,163 (GRCm39) Y138H probably damaging Het
Ngef T C 1: 87,473,690 (GRCm39) R31G probably benign Het
Nipsnap2 C A 5: 129,830,287 (GRCm39) probably null Het
Nlgn2 G T 11: 69,719,267 (GRCm39) N194K probably damaging Het
Or1q1 G A 2: 36,887,664 (GRCm39) V281M possibly damaging Het
Or4a72 A T 2: 89,405,305 (GRCm39) M255K possibly damaging Het
Or5b98 G A 19: 12,931,696 (GRCm39) V248I possibly damaging Het
Or5m13b A G 2: 85,754,087 (GRCm39) I158M probably benign Het
Or8c16 A G 9: 38,130,728 (GRCm39) Y203C possibly damaging Het
Pcca T A 14: 123,050,634 (GRCm39) M101K possibly damaging Het
Plekha6 A G 1: 133,212,708 (GRCm39) T671A possibly damaging Het
Prex2 G A 1: 11,232,536 (GRCm39) V868M probably damaging Het
Prom1 T A 5: 44,168,595 (GRCm39) probably benign Het
Ptprd A G 4: 76,051,398 (GRCm39) V41A probably damaging Het
Rab39 C T 9: 53,597,698 (GRCm39) G189E possibly damaging Het
Ret T C 6: 118,157,343 (GRCm39) K236E possibly damaging Het
Rfx6 G A 10: 51,596,153 (GRCm39) probably null Het
Rnf213 A G 11: 119,352,744 (GRCm39) T3916A probably damaging Het
Rpn1 A G 6: 88,072,665 (GRCm39) N336S probably damaging Het
Sag G A 1: 87,733,037 (GRCm39) A2T probably damaging Het
Sco2 T C 15: 89,256,063 (GRCm39) Y197C probably damaging Het
Sec23b T C 2: 144,408,864 (GRCm39) I183T possibly damaging Het
Sec24b C T 3: 129,781,377 (GRCm39) V1166M probably damaging Het
Slc27a5 A T 7: 12,727,339 (GRCm39) F361Y probably damaging Het
Spaca9 A G 2: 28,586,013 (GRCm39) L17P probably damaging Het
Sqor T C 2: 122,646,027 (GRCm39) probably null Het
Stx18 A G 5: 38,292,588 (GRCm39) H230R probably damaging Het
Tas2r130 A T 6: 131,607,732 (GRCm39) I21N probably damaging Het
Tcaf3 A G 6: 42,570,658 (GRCm39) S365P possibly damaging Het
Tinagl1 G A 4: 130,060,765 (GRCm39) H351Y probably damaging Het
Tmc2 T C 2: 130,074,305 (GRCm39) Y333H probably damaging Het
Trp53bp2 A T 1: 182,270,384 (GRCm39) T395S probably damaging Het
Tsc22d1 T C 14: 76,655,773 (GRCm39) S751P probably damaging Het
Ttn A G 2: 76,657,368 (GRCm39) probably benign Het
Ugdh T C 5: 65,574,268 (GRCm39) Y425C probably damaging Het
Vmn1r115 G A 7: 20,578,094 (GRCm39) L273F probably null Het
Vmn2r109 A T 17: 20,761,448 (GRCm39) C636* probably null Het
Vmn2r59 A C 7: 41,693,203 (GRCm39) Y466D probably damaging Het
Zic5 C T 14: 122,702,242 (GRCm39) G163D unknown Het
Other mutations in Prkcq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01654:Prkcq APN 2 11,288,654 (GRCm39) missense probably damaging 1.00
IGL01656:Prkcq APN 2 11,231,766 (GRCm39) missense probably damaging 1.00
IGL01732:Prkcq APN 2 11,265,644 (GRCm39) splice site probably benign
IGL02136:Prkcq APN 2 11,265,479 (GRCm39) missense probably benign 0.00
IGL02161:Prkcq APN 2 11,281,887 (GRCm39) missense probably benign
IGL02178:Prkcq APN 2 11,281,851 (GRCm39) missense possibly damaging 0.93
IGL03107:Prkcq APN 2 11,265,597 (GRCm39) missense probably damaging 1.00
IGL03149:Prkcq APN 2 11,237,356 (GRCm39) missense probably benign 0.11
banks UTSW 2 11,304,221 (GRCm39) missense probably damaging 1.00
celina UTSW 2 11,288,660 (GRCm39) missense possibly damaging 0.82
celina2 UTSW 2 11,231,797 (GRCm39) critical splice donor site probably null
Megabytes UTSW 2 11,295,262 (GRCm39) nonsense probably null
Monmouth UTSW 2 11,284,335 (GRCm39) missense probably damaging 1.00
3-1:Prkcq UTSW 2 11,304,905 (GRCm39) missense probably damaging 1.00
K3955:Prkcq UTSW 2 11,251,604 (GRCm39) splice site probably benign
R0049:Prkcq UTSW 2 11,288,643 (GRCm39) missense probably benign 0.04
R0049:Prkcq UTSW 2 11,288,643 (GRCm39) missense probably benign 0.04
R0183:Prkcq UTSW 2 11,257,973 (GRCm39) missense probably damaging 1.00
R0366:Prkcq UTSW 2 11,251,649 (GRCm39) splice site probably benign
R0388:Prkcq UTSW 2 11,259,045 (GRCm39) missense probably benign
R1385:Prkcq UTSW 2 11,261,097 (GRCm39) missense probably damaging 1.00
R1687:Prkcq UTSW 2 11,295,344 (GRCm39) missense probably damaging 1.00
R1693:Prkcq UTSW 2 11,259,010 (GRCm39) missense probably damaging 0.99
R1760:Prkcq UTSW 2 11,304,881 (GRCm39) missense probably damaging 1.00
R1764:Prkcq UTSW 2 11,237,442 (GRCm39) missense probably damaging 1.00
R1968:Prkcq UTSW 2 11,250,208 (GRCm39) missense probably damaging 1.00
R2108:Prkcq UTSW 2 11,237,380 (GRCm39) missense probably damaging 1.00
R2762:Prkcq UTSW 2 11,237,451 (GRCm39) missense possibly damaging 0.75
R3402:Prkcq UTSW 2 11,288,660 (GRCm39) missense possibly damaging 0.82
R3429:Prkcq UTSW 2 11,251,781 (GRCm39) missense probably damaging 1.00
R3545:Prkcq UTSW 2 11,288,627 (GRCm39) missense probably benign 0.11
R3547:Prkcq UTSW 2 11,288,627 (GRCm39) missense probably benign 0.11
R3893:Prkcq UTSW 2 11,231,782 (GRCm39) missense probably damaging 1.00
R4086:Prkcq UTSW 2 11,288,679 (GRCm39) missense probably damaging 0.97
R4423:Prkcq UTSW 2 11,260,980 (GRCm39) missense possibly damaging 0.66
R4541:Prkcq UTSW 2 11,288,623 (GRCm39) missense possibly damaging 0.84
R4649:Prkcq UTSW 2 11,284,333 (GRCm39) missense possibly damaging 0.83
R4652:Prkcq UTSW 2 11,284,333 (GRCm39) missense possibly damaging 0.83
R4820:Prkcq UTSW 2 11,231,797 (GRCm39) critical splice donor site probably null
R5197:Prkcq UTSW 2 11,304,227 (GRCm39) missense probably damaging 1.00
R6008:Prkcq UTSW 2 11,261,097 (GRCm39) missense probably damaging 1.00
R7030:Prkcq UTSW 2 11,231,661 (GRCm39) splice site probably null
R7231:Prkcq UTSW 2 11,295,262 (GRCm39) nonsense probably null
R7461:Prkcq UTSW 2 11,304,221 (GRCm39) missense probably damaging 1.00
R7613:Prkcq UTSW 2 11,304,221 (GRCm39) missense probably damaging 1.00
R8441:Prkcq UTSW 2 11,253,037 (GRCm39) missense probably benign 0.11
R8491:Prkcq UTSW 2 11,284,335 (GRCm39) missense probably damaging 1.00
R8724:Prkcq UTSW 2 11,304,784 (GRCm39) missense probably benign 0.17
R9031:Prkcq UTSW 2 11,251,819 (GRCm39) missense probably damaging 0.99
R9164:Prkcq UTSW 2 11,231,716 (GRCm39) missense probably damaging 0.96
R9621:Prkcq UTSW 2 11,261,014 (GRCm39) missense probably benign 0.00
R9661:Prkcq UTSW 2 11,250,141 (GRCm39) nonsense probably null
Z1177:Prkcq UTSW 2 11,304,192 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GGGGTTTACTCTGCTGTCCC -3'
(R):5'- GACCCAGAAGCACGAGGTAC -3'

Sequencing Primer
(F):5'- CTGTCCTCATGCTGTGTCTTGG -3'
(R):5'- TAATGTTGTCAGAGATGAATAGTGGC -3'
Posted On 2014-08-25