Incidental Mutation 'R0142:Plcz1'
ID22375
Institutional Source Beutler Lab
Gene Symbol Plcz1
Ensembl Gene ENSMUSG00000030230
Gene Namephospholipase C, zeta 1
Synonyms1700041H07Rik
MMRRC Submission 038427-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0142 (G1)
Quality Score218
Status Validated (trace)
Chromosome6
Chromosomal Location139989673-140041457 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 140007697 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 398 (F398S)
Ref Sequence ENSEMBL: ENSMUSP00000032356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032356] [ENSMUST00000129986] [ENSMUST00000137148]
Predicted Effect probably damaging
Transcript: ENSMUST00000032356
AA Change: F398S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032356
Gene: ENSMUSG00000030230
AA Change: F398S

DomainStartEndE-ValueType
Pfam:EF-hand_like 80 162 9.6e-26 PFAM
PLCXc 163 307 5.17e-72 SMART
low complexity region 374 385 N/A INTRINSIC
PLCYc 386 502 1.52e-51 SMART
C2 521 625 2.06e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129986
Predicted Effect probably benign
Transcript: ENSMUST00000137148
Meta Mutation Damage Score 0.7824 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 87.6%
Validation Efficiency 92% (61/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the phosphoinositide-specific phospholipase C family. Members in this family, classified into six isotypes that are tissue- and organ-specific, hydrolyze phosphatidylinositol 4,5-bisphosphate just before the phosphate group to yield diacylglycerol and inositol 1,4,5-trisphosphate. This protein localizes to the acrosome in spermatozoa and elicits Ca(2+) oscillations and egg activation during fertilization that leads to early embryonic development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
PHENOTYPE: Homozygous knockout mice display normal spermatogenesis and sperm motility but are sub-fertile because of a failure to induce Ca2+ oscillations in oocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A G 19: 29,718,254 S1347P possibly damaging Het
Abca6 T G 11: 110,188,641 D1229A probably damaging Het
Abhd8 A C 8: 71,461,862 F41V probably damaging Het
Ago4 T G 4: 126,516,932 E222A probably benign Het
Ap3b2 T C 7: 81,473,080 I470V probably damaging Het
Bcl9l C T 9: 44,507,112 T749M probably benign Het
Bicc1 T C 10: 70,925,370 K937E probably damaging Het
Bmi1 G A 2: 18,683,284 probably null Het
Boc A C 16: 44,490,241 I772S probably damaging Het
C2 T A 17: 34,873,528 I178F possibly damaging Het
Cacna1c G T 6: 118,603,882 A1416E probably damaging Het
Chst10 A G 1: 38,871,729 L118P probably damaging Het
Crybg1 G A 10: 43,999,063 T683I possibly damaging Het
Cul5 C T 9: 53,635,050 V314I probably damaging Het
Dnajc17 C A 2: 119,179,934 R211I probably benign Het
Emilin1 A G 5: 30,913,920 T16A probably benign Het
Ercc6l2 A C 13: 63,872,506 probably benign Het
Fsd2 T A 7: 81,559,935 D53V probably damaging Het
Galnt13 A G 2: 55,098,603 D479G probably damaging Het
Grk3 A T 5: 112,915,053 W643R probably damaging Het
Hdgf G A 3: 87,913,109 A4T possibly damaging Het
Hnrnpr T A 4: 136,327,282 V182E probably damaging Het
Ipo13 A C 4: 117,905,569 L279R probably damaging Het
Itga9 C A 9: 118,636,586 N169K probably damaging Het
Jph3 A G 8: 121,753,371 T263A possibly damaging Het
Jph4 G T 14: 55,108,326 Q625K probably benign Het
Kctd3 A C 1: 188,996,398 probably null Het
Kif26b A T 1: 178,915,389 S570C probably damaging Het
Klhl5 G A 5: 65,143,350 W164* probably null Het
Lacc1 A T 14: 77,030,799 H357Q probably benign Het
Lama2 A G 10: 27,187,845 I1316T probably benign Het
Lcp2 C T 11: 34,082,418 P332L probably damaging Het
Map3k6 A T 4: 133,250,946 H1033L probably benign Het
Mfsd2b A G 12: 4,866,234 V252A probably benign Het
Myo16 T A 8: 10,569,790 I1447N probably benign Het
Myo19 G A 11: 84,894,603 R224H probably damaging Het
Myo5a C T 9: 75,160,574 H637Y probably benign Het
Nek10 C T 14: 14,861,560 R539C possibly damaging Het
Nfix A T 8: 84,721,686 V404E probably damaging Het
Nr1i2 T C 16: 38,253,006 R203G probably benign Het
Nup210l G A 3: 90,172,113 G968D probably damaging Het
Olfr1494 A T 19: 13,749,255 I50F probably benign Het
Olfr697 G T 7: 106,741,765 H56Q probably benign Het
Olfr884 A T 9: 38,048,110 H296L probably benign Het
Phlpp2 C T 8: 109,907,513 R242W probably damaging Het
Ppfibp2 C A 7: 107,744,177 P808T probably damaging Het
Srpk2 T C 5: 23,527,930 K239E probably damaging Het
Svep1 A G 4: 58,118,232 V830A probably benign Het
Tesc A T 5: 118,056,570 I149F possibly damaging Het
Thsd7a A G 6: 12,418,335 W632R probably damaging Het
Tmprss9 A G 10: 80,894,378 D704G possibly damaging Het
Tob1 T C 11: 94,214,597 Y320H probably damaging Het
Trpm3 G T 19: 22,987,916 D1582Y probably damaging Het
Ttc28 A G 5: 111,277,457 K1716R probably benign Het
Uqcrfs1 A G 13: 30,540,942 V205A probably benign Het
Usp29 G A 7: 6,962,335 M392I probably benign Het
Uspl1 A T 5: 149,188,349 Y22F possibly damaging Het
Virma C A 4: 11,548,783 N1780K probably benign Het
Vmn1r56 C T 7: 5,196,373 A82T probably benign Het
Vmn2r5 A T 3: 64,492,588 C553S probably damaging Het
Vwce A T 19: 10,664,612 R901W probably damaging Het
Wdpcp C A 11: 21,857,444 probably null Het
Zfp423 A T 8: 87,780,340 C1000* probably null Het
Zscan20 A G 4: 128,585,837 F954L probably benign Het
Other mutations in Plcz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01599:Plcz1 APN 6 140002256 splice site probably benign
IGL01825:Plcz1 APN 6 140003916 missense probably benign 0.03
IGL01885:Plcz1 APN 6 140002111 missense probably benign 0.14
IGL02539:Plcz1 APN 6 139992964 missense probably benign 0.06
IGL02754:Plcz1 APN 6 140010581 missense probably benign 0.00
IGL03379:Plcz1 APN 6 139990764 missense possibly damaging 0.69
IGL03412:Plcz1 APN 6 140016097 missense probably damaging 0.99
R0005:Plcz1 UTSW 6 140040564 splice site probably benign
R0034:Plcz1 UTSW 6 140020448 utr 3 prime probably benign
R0078:Plcz1 UTSW 6 139989784 missense probably damaging 1.00
R0200:Plcz1 UTSW 6 139990733 missense probably damaging 1.00
R0399:Plcz1 UTSW 6 140023230 missense possibly damaging 0.95
R0599:Plcz1 UTSW 6 140028542 missense probably benign
R0608:Plcz1 UTSW 6 139990733 missense probably damaging 1.00
R1854:Plcz1 UTSW 6 139993049 missense probably benign 0.36
R2212:Plcz1 UTSW 6 140002081 missense probably damaging 0.98
R2895:Plcz1 UTSW 6 140023151 missense possibly damaging 0.79
R3413:Plcz1 UTSW 6 140002081 missense probably damaging 0.98
R4239:Plcz1 UTSW 6 140040618 unclassified probably null
R4441:Plcz1 UTSW 6 139990687 missense probably benign 0.00
R4889:Plcz1 UTSW 6 140007748 missense probably benign 0.00
R4953:Plcz1 UTSW 6 140028551 missense possibly damaging 0.89
R5175:Plcz1 UTSW 6 140039663 missense possibly damaging 0.94
R5359:Plcz1 UTSW 6 140028452 missense probably damaging 1.00
R5401:Plcz1 UTSW 6 139993052 splice site probably null
R5505:Plcz1 UTSW 6 140016216 missense probably damaging 0.99
R5558:Plcz1 UTSW 6 140039755 missense probably damaging 1.00
R5581:Plcz1 UTSW 6 140023125 missense probably damaging 1.00
R6252:Plcz1 UTSW 6 140007603 critical splice donor site probably null
R6569:Plcz1 UTSW 6 140007707 missense possibly damaging 0.62
R6750:Plcz1 UTSW 6 140028438 missense possibly damaging 0.74
R7073:Plcz1 UTSW 6 140023123 nonsense probably null
R7204:Plcz1 UTSW 6 140010424 missense probably benign 0.05
R7309:Plcz1 UTSW 6 140023156 missense probably damaging 1.00
R7446:Plcz1 UTSW 6 140013586 missense possibly damaging 0.63
R7503:Plcz1 UTSW 6 139990748 missense probably damaging 1.00
R7634:Plcz1 UTSW 6 140016127 missense probably damaging 1.00
Z1176:Plcz1 UTSW 6 140013676 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- CCCCAATCCATATTAACCCCTTAGCG -3'
(R):5'- ACCTAAGATCCTTGGAGGCCAAGAAAA -3'

Sequencing Primer
(F):5'- ACCCCTTAGCGATTAATAGAACTG -3'
(R):5'- TTTTTAGAAGAGGAAGATGA -3'
Posted On2013-04-16