Incidental Mutation 'R2020:Or1q1'
ID 223753
Institutional Source Beutler Lab
Gene Symbol Or1q1
Ensembl Gene ENSMUSG00000055838
Gene Name olfactory receptor family 1 subfamily Q member 1
Synonyms GA_x6K02T2NLDC-33688556-33689482, MOR138-3, Olfr357
MMRRC Submission 040029-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.097) question?
Stock # R2020 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 36886824-36887750 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 36887664 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 281 (V281M)
Ref Sequence ENSEMBL: ENSMUSP00000149727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069578] [ENSMUST00000213218] [ENSMUST00000216437]
AlphaFold Q8VFP4
Predicted Effect possibly damaging
Transcript: ENSMUST00000069578
AA Change: V281M

PolyPhen 2 Score 0.850 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000066272
Gene: ENSMUSG00000055838
AA Change: V281M

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 3.6e-53 PFAM
Pfam:7tm_1 41 290 1.2e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213218
AA Change: V281M

PolyPhen 2 Score 0.850 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000216437
Meta Mutation Damage Score 0.1897 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.6%
Validation Efficiency 99% (87/88)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012P17Rik C A 1: 158,796,482 (GRCm39) noncoding transcript Het
Adam17 G A 12: 21,399,876 (GRCm39) R177C probably damaging Het
Ak7 G A 12: 105,711,591 (GRCm39) probably null Het
Akap9 T C 5: 4,011,967 (GRCm39) V890A probably damaging Het
Alg6 A G 4: 99,626,369 (GRCm39) N59S probably damaging Het
Alkbh5 G T 11: 60,429,375 (GRCm39) A43S probably benign Het
Anxa2 C A 9: 69,391,099 (GRCm39) D162E probably damaging Het
Arap1 A G 7: 101,050,725 (GRCm39) H1136R probably benign Het
Arhgap18 A G 10: 26,730,900 (GRCm39) R121G probably benign Het
Arhgef4 A T 1: 34,762,891 (GRCm39) T716S unknown Het
Atg2a T C 19: 6,300,299 (GRCm39) probably null Het
Ccdc27 T C 4: 154,117,770 (GRCm39) I480V probably null Het
Cdipt T C 7: 126,576,105 (GRCm39) V20A possibly damaging Het
Cgrrf1 C T 14: 47,067,902 (GRCm39) probably benign Het
Chd7 G A 4: 8,855,226 (GRCm39) V2152I probably benign Het
Chd8 T A 14: 52,452,698 (GRCm39) S1274C probably damaging Het
Chuk A T 19: 44,095,782 (GRCm39) M17K possibly damaging Het
Col14a1 C T 15: 55,309,577 (GRCm39) probably benign Het
Col20a1 G A 2: 180,654,956 (GRCm39) probably null Het
Cped1 A G 6: 22,143,963 (GRCm39) I570V probably benign Het
Cul9 C G 17: 46,833,101 (GRCm39) A1326P probably damaging Het
Ddx27 A C 2: 166,875,691 (GRCm39) Q674P probably damaging Het
Dennd6a T A 14: 26,333,158 (GRCm39) F131L probably damaging Het
Dhx38 G A 8: 110,283,501 (GRCm39) probably benign Het
Dido1 G T 2: 180,301,378 (GRCm39) N2175K unknown Het
Dmxl1 T A 18: 50,022,625 (GRCm39) Y1654* probably null Het
Dock7 T A 4: 98,847,338 (GRCm39) H1658L probably damaging Het
Dync2h1 T A 9: 7,122,772 (GRCm39) E2061D probably damaging Het
Dync2h1 T C 9: 7,162,925 (GRCm39) I555V probably benign Het
Eif2ak2 T C 17: 79,171,392 (GRCm39) E337G possibly damaging Het
Fabp12 T A 3: 10,315,209 (GRCm39) D46V probably benign Het
Fcgbpl1 T C 7: 27,855,019 (GRCm39) S1882P probably benign Het
Fech C T 18: 64,611,798 (GRCm39) E79K probably damaging Het
Flnc A T 6: 29,444,362 (GRCm39) I693F probably damaging Het
Foxp2 G A 6: 15,324,643 (GRCm39) C97Y possibly damaging Het
Grin2b A G 6: 135,710,894 (GRCm39) M884T probably benign Het
Gtf2ird1 T C 5: 134,445,947 (GRCm39) D28G probably damaging Het
Gtf3c4 C A 2: 28,723,906 (GRCm39) G468W possibly damaging Het
Ift172 A T 5: 31,424,585 (GRCm39) L201* probably null Het
Ift70a1 A G 2: 75,811,279 (GRCm39) V268A probably benign Het
Il1rl2 C A 1: 40,404,374 (GRCm39) S498R probably damaging Het
Ildr1 C T 16: 36,545,903 (GRCm39) R489W probably damaging Het
Itga10 G A 3: 96,559,806 (GRCm39) G487D probably damaging Het
Klk1b8 A G 7: 43,448,640 (GRCm39) N128D probably benign Het
Lgr6 G A 1: 135,003,013 (GRCm39) T79M probably damaging Het
Med6 T C 12: 81,620,651 (GRCm39) T232A probably benign Het
Mgat4e A G 1: 134,469,060 (GRCm39) L328P probably damaging Het
Mttp A G 3: 137,824,163 (GRCm39) Y138H probably damaging Het
Ngef T C 1: 87,473,690 (GRCm39) R31G probably benign Het
Nipsnap2 C A 5: 129,830,287 (GRCm39) probably null Het
Nlgn2 G T 11: 69,719,267 (GRCm39) N194K probably damaging Het
Or4a72 A T 2: 89,405,305 (GRCm39) M255K possibly damaging Het
Or5b98 G A 19: 12,931,696 (GRCm39) V248I possibly damaging Het
Or5m13b A G 2: 85,754,087 (GRCm39) I158M probably benign Het
Or8c16 A G 9: 38,130,728 (GRCm39) Y203C possibly damaging Het
Pcca T A 14: 123,050,634 (GRCm39) M101K possibly damaging Het
Plekha6 A G 1: 133,212,708 (GRCm39) T671A possibly damaging Het
Prex2 G A 1: 11,232,536 (GRCm39) V868M probably damaging Het
Prkcq G A 2: 11,284,332 (GRCm39) V501I probably benign Het
Prom1 T A 5: 44,168,595 (GRCm39) probably benign Het
Ptprd A G 4: 76,051,398 (GRCm39) V41A probably damaging Het
Rab39 C T 9: 53,597,698 (GRCm39) G189E possibly damaging Het
Ret T C 6: 118,157,343 (GRCm39) K236E possibly damaging Het
Rfx6 G A 10: 51,596,153 (GRCm39) probably null Het
Rnf213 A G 11: 119,352,744 (GRCm39) T3916A probably damaging Het
Rpn1 A G 6: 88,072,665 (GRCm39) N336S probably damaging Het
Sag G A 1: 87,733,037 (GRCm39) A2T probably damaging Het
Sco2 T C 15: 89,256,063 (GRCm39) Y197C probably damaging Het
Sec23b T C 2: 144,408,864 (GRCm39) I183T possibly damaging Het
Sec24b C T 3: 129,781,377 (GRCm39) V1166M probably damaging Het
Slc27a5 A T 7: 12,727,339 (GRCm39) F361Y probably damaging Het
Spaca9 A G 2: 28,586,013 (GRCm39) L17P probably damaging Het
Sqor T C 2: 122,646,027 (GRCm39) probably null Het
Stx18 A G 5: 38,292,588 (GRCm39) H230R probably damaging Het
Tas2r130 A T 6: 131,607,732 (GRCm39) I21N probably damaging Het
Tcaf3 A G 6: 42,570,658 (GRCm39) S365P possibly damaging Het
Tinagl1 G A 4: 130,060,765 (GRCm39) H351Y probably damaging Het
Tmc2 T C 2: 130,074,305 (GRCm39) Y333H probably damaging Het
Trp53bp2 A T 1: 182,270,384 (GRCm39) T395S probably damaging Het
Tsc22d1 T C 14: 76,655,773 (GRCm39) S751P probably damaging Het
Ttn A G 2: 76,657,368 (GRCm39) probably benign Het
Ugdh T C 5: 65,574,268 (GRCm39) Y425C probably damaging Het
Vmn1r115 G A 7: 20,578,094 (GRCm39) L273F probably null Het
Vmn2r109 A T 17: 20,761,448 (GRCm39) C636* probably null Het
Vmn2r59 A C 7: 41,693,203 (GRCm39) Y466D probably damaging Het
Zic5 C T 14: 122,702,242 (GRCm39) G163D unknown Het
Other mutations in Or1q1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01561:Or1q1 APN 2 36,886,955 (GRCm39) missense probably benign
IGL02043:Or1q1 APN 2 36,887,477 (GRCm39) nonsense probably null
IGL02277:Or1q1 APN 2 36,887,196 (GRCm39) splice site probably null
IGL03037:Or1q1 APN 2 36,887,560 (GRCm39) missense probably benign 0.00
IGL03378:Or1q1 APN 2 36,886,915 (GRCm39) missense probably damaging 1.00
R0212:Or1q1 UTSW 2 36,887,644 (GRCm39) missense possibly damaging 0.92
R0212:Or1q1 UTSW 2 36,887,335 (GRCm39) missense probably damaging 0.98
R1334:Or1q1 UTSW 2 36,886,872 (GRCm39) missense probably benign 0.27
R1704:Or1q1 UTSW 2 36,886,896 (GRCm39) missense probably benign 0.34
R2364:Or1q1 UTSW 2 36,887,577 (GRCm39) missense probably damaging 1.00
R4700:Or1q1 UTSW 2 36,887,515 (GRCm39) missense probably benign 0.01
R5105:Or1q1 UTSW 2 36,887,469 (GRCm39) splice site probably null
R5234:Or1q1 UTSW 2 36,887,107 (GRCm39) missense probably benign
R5557:Or1q1 UTSW 2 36,887,358 (GRCm39) missense probably damaging 1.00
R5966:Or1q1 UTSW 2 36,886,957 (GRCm39) missense possibly damaging 0.96
R6480:Or1q1 UTSW 2 36,887,007 (GRCm39) missense probably benign 0.00
R7046:Or1q1 UTSW 2 36,887,173 (GRCm39) missense probably benign 0.39
R7350:Or1q1 UTSW 2 36,886,873 (GRCm39) missense possibly damaging 0.84
R7583:Or1q1 UTSW 2 36,887,092 (GRCm39) missense probably damaging 1.00
R8128:Or1q1 UTSW 2 36,887,673 (GRCm39) missense probably benign 0.13
R8196:Or1q1 UTSW 2 36,886,873 (GRCm39) missense possibly damaging 0.84
R8475:Or1q1 UTSW 2 36,887,066 (GRCm39) missense probably damaging 0.99
R8867:Or1q1 UTSW 2 36,887,691 (GRCm39) missense probably damaging 1.00
R9550:Or1q1 UTSW 2 36,887,137 (GRCm39) missense probably damaging 1.00
R9627:Or1q1 UTSW 2 36,887,665 (GRCm39) missense
R9716:Or1q1 UTSW 2 36,887,290 (GRCm39) missense probably damaging 0.98
Z1088:Or1q1 UTSW 2 36,887,717 (GRCm39) missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- ATCATCTCAGCAGTCCTCCG -3'
(R):5'- AAGTTGGATCTTGTGCACACTAAAC -3'

Sequencing Primer
(F):5'- GGATCCCCTCTGCCAATG -3'
(R):5'- TGGATTCTCTAGCCCAGGCATG -3'
Posted On 2014-08-25