Incidental Mutation 'R2020:Or4a72'
ID 223761
Institutional Source Beutler Lab
Gene Symbol Or4a72
Ensembl Gene ENSMUSG00000111456
Gene Name olfactory receptor family 4 subfamily A member 72
Synonyms GA_x6K02T2Q125-51020951-51020028, MOR231-12, Olfr1245
MMRRC Submission 040029-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.246) question?
Stock # R2020 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 89405056-89406117 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 89405305 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 255 (M255K)
Gene Model predicted gene model for transcript(s): [ENSMUST00000214870] [ENSMUST00000217402]
AlphaFold A0A1L1SQJ6
Predicted Effect possibly damaging
Transcript: ENSMUST00000099766
AA Change: M255K

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097354
Gene: ENSMUSG00000100601
AA Change: M255K

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 6e-49 PFAM
Pfam:7tm_1 39 285 2.8e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000099773
AA Change: M255K

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097361
Gene: ENSMUSG00000075083
AA Change: M255K

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 3.2e-48 PFAM
Pfam:7tm_1 39 285 3e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214870
AA Change: M255K

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217402
AA Change: M255K

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.6%
Validation Efficiency 99% (87/88)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012P17Rik C A 1: 158,796,482 (GRCm39) noncoding transcript Het
Adam17 G A 12: 21,399,876 (GRCm39) R177C probably damaging Het
Ak7 G A 12: 105,711,591 (GRCm39) probably null Het
Akap9 T C 5: 4,011,967 (GRCm39) V890A probably damaging Het
Alg6 A G 4: 99,626,369 (GRCm39) N59S probably damaging Het
Alkbh5 G T 11: 60,429,375 (GRCm39) A43S probably benign Het
Anxa2 C A 9: 69,391,099 (GRCm39) D162E probably damaging Het
Arap1 A G 7: 101,050,725 (GRCm39) H1136R probably benign Het
Arhgap18 A G 10: 26,730,900 (GRCm39) R121G probably benign Het
Arhgef4 A T 1: 34,762,891 (GRCm39) T716S unknown Het
Atg2a T C 19: 6,300,299 (GRCm39) probably null Het
Ccdc27 T C 4: 154,117,770 (GRCm39) I480V probably null Het
Cdipt T C 7: 126,576,105 (GRCm39) V20A possibly damaging Het
Cgrrf1 C T 14: 47,067,902 (GRCm39) probably benign Het
Chd7 G A 4: 8,855,226 (GRCm39) V2152I probably benign Het
Chd8 T A 14: 52,452,698 (GRCm39) S1274C probably damaging Het
Chuk A T 19: 44,095,782 (GRCm39) M17K possibly damaging Het
Col14a1 C T 15: 55,309,577 (GRCm39) probably benign Het
Col20a1 G A 2: 180,654,956 (GRCm39) probably null Het
Cped1 A G 6: 22,143,963 (GRCm39) I570V probably benign Het
Cul9 C G 17: 46,833,101 (GRCm39) A1326P probably damaging Het
Ddx27 A C 2: 166,875,691 (GRCm39) Q674P probably damaging Het
Dennd6a T A 14: 26,333,158 (GRCm39) F131L probably damaging Het
Dhx38 G A 8: 110,283,501 (GRCm39) probably benign Het
Dido1 G T 2: 180,301,378 (GRCm39) N2175K unknown Het
Dmxl1 T A 18: 50,022,625 (GRCm39) Y1654* probably null Het
Dock7 T A 4: 98,847,338 (GRCm39) H1658L probably damaging Het
Dync2h1 T A 9: 7,122,772 (GRCm39) E2061D probably damaging Het
Dync2h1 T C 9: 7,162,925 (GRCm39) I555V probably benign Het
Eif2ak2 T C 17: 79,171,392 (GRCm39) E337G possibly damaging Het
Fabp12 T A 3: 10,315,209 (GRCm39) D46V probably benign Het
Fcgbpl1 T C 7: 27,855,019 (GRCm39) S1882P probably benign Het
Fech C T 18: 64,611,798 (GRCm39) E79K probably damaging Het
Flnc A T 6: 29,444,362 (GRCm39) I693F probably damaging Het
Foxp2 G A 6: 15,324,643 (GRCm39) C97Y possibly damaging Het
Grin2b A G 6: 135,710,894 (GRCm39) M884T probably benign Het
Gtf2ird1 T C 5: 134,445,947 (GRCm39) D28G probably damaging Het
Gtf3c4 C A 2: 28,723,906 (GRCm39) G468W possibly damaging Het
Ift172 A T 5: 31,424,585 (GRCm39) L201* probably null Het
Ift70a1 A G 2: 75,811,279 (GRCm39) V268A probably benign Het
Il1rl2 C A 1: 40,404,374 (GRCm39) S498R probably damaging Het
Ildr1 C T 16: 36,545,903 (GRCm39) R489W probably damaging Het
Itga10 G A 3: 96,559,806 (GRCm39) G487D probably damaging Het
Klk1b8 A G 7: 43,448,640 (GRCm39) N128D probably benign Het
Lgr6 G A 1: 135,003,013 (GRCm39) T79M probably damaging Het
Med6 T C 12: 81,620,651 (GRCm39) T232A probably benign Het
Mgat4e A G 1: 134,469,060 (GRCm39) L328P probably damaging Het
Mttp A G 3: 137,824,163 (GRCm39) Y138H probably damaging Het
Ngef T C 1: 87,473,690 (GRCm39) R31G probably benign Het
Nipsnap2 C A 5: 129,830,287 (GRCm39) probably null Het
Nlgn2 G T 11: 69,719,267 (GRCm39) N194K probably damaging Het
Or1q1 G A 2: 36,887,664 (GRCm39) V281M possibly damaging Het
Or5b98 G A 19: 12,931,696 (GRCm39) V248I possibly damaging Het
Or5m13b A G 2: 85,754,087 (GRCm39) I158M probably benign Het
Or8c16 A G 9: 38,130,728 (GRCm39) Y203C possibly damaging Het
Pcca T A 14: 123,050,634 (GRCm39) M101K possibly damaging Het
Plekha6 A G 1: 133,212,708 (GRCm39) T671A possibly damaging Het
Prex2 G A 1: 11,232,536 (GRCm39) V868M probably damaging Het
Prkcq G A 2: 11,284,332 (GRCm39) V501I probably benign Het
Prom1 T A 5: 44,168,595 (GRCm39) probably benign Het
Ptprd A G 4: 76,051,398 (GRCm39) V41A probably damaging Het
Rab39 C T 9: 53,597,698 (GRCm39) G189E possibly damaging Het
Ret T C 6: 118,157,343 (GRCm39) K236E possibly damaging Het
Rfx6 G A 10: 51,596,153 (GRCm39) probably null Het
Rnf213 A G 11: 119,352,744 (GRCm39) T3916A probably damaging Het
Rpn1 A G 6: 88,072,665 (GRCm39) N336S probably damaging Het
Sag G A 1: 87,733,037 (GRCm39) A2T probably damaging Het
Sco2 T C 15: 89,256,063 (GRCm39) Y197C probably damaging Het
Sec23b T C 2: 144,408,864 (GRCm39) I183T possibly damaging Het
Sec24b C T 3: 129,781,377 (GRCm39) V1166M probably damaging Het
Slc27a5 A T 7: 12,727,339 (GRCm39) F361Y probably damaging Het
Spaca9 A G 2: 28,586,013 (GRCm39) L17P probably damaging Het
Sqor T C 2: 122,646,027 (GRCm39) probably null Het
Stx18 A G 5: 38,292,588 (GRCm39) H230R probably damaging Het
Tas2r130 A T 6: 131,607,732 (GRCm39) I21N probably damaging Het
Tcaf3 A G 6: 42,570,658 (GRCm39) S365P possibly damaging Het
Tinagl1 G A 4: 130,060,765 (GRCm39) H351Y probably damaging Het
Tmc2 T C 2: 130,074,305 (GRCm39) Y333H probably damaging Het
Trp53bp2 A T 1: 182,270,384 (GRCm39) T395S probably damaging Het
Tsc22d1 T C 14: 76,655,773 (GRCm39) S751P probably damaging Het
Ttn A G 2: 76,657,368 (GRCm39) probably benign Het
Ugdh T C 5: 65,574,268 (GRCm39) Y425C probably damaging Het
Vmn1r115 G A 7: 20,578,094 (GRCm39) L273F probably null Het
Vmn2r109 A T 17: 20,761,448 (GRCm39) C636* probably null Het
Vmn2r59 A C 7: 41,693,203 (GRCm39) Y466D probably damaging Het
Zic5 C T 14: 122,702,242 (GRCm39) G163D unknown Het
Other mutations in Or4a72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Or4a72 APN 2 89,405,767 (GRCm39) missense possibly damaging 0.68
IGL01690:Or4a72 APN 2 89,405,557 (GRCm39) missense probably benign 0.09
IGL02334:Or4a72 APN 2 89,405,668 (GRCm39) missense possibly damaging 0.95
IGL02435:Or4a72 APN 2 89,405,890 (GRCm39) missense probably damaging 0.99
IGL02793:Or4a72 APN 2 89,405,896 (GRCm39) missense probably damaging 1.00
IGL02875:Or4a72 APN 2 89,405,896 (GRCm39) missense probably damaging 1.00
IGL03218:Or4a72 APN 2 89,405,935 (GRCm39) missense probably benign 0.09
IGL03392:Or4a72 APN 2 89,405,593 (GRCm39) missense probably damaging 0.96
H8786:Or4a72 UTSW 2 89,405,623 (GRCm39) missense probably damaging 1.00
I0000:Or4a72 UTSW 2 89,405,497 (GRCm39) missense probably damaging 1.00
R0044:Or4a72 UTSW 2 89,405,974 (GRCm39) missense possibly damaging 0.68
R0190:Or4a72 UTSW 2 89,405,302 (GRCm39) missense probably damaging 0.98
R1585:Or4a72 UTSW 2 89,405,746 (GRCm39) missense possibly damaging 0.89
R1902:Or4a72 UTSW 2 89,405,947 (GRCm39) missense possibly damaging 0.77
R2018:Or4a72 UTSW 2 89,405,737 (GRCm39) missense probably damaging 0.97
R2019:Or4a72 UTSW 2 89,405,737 (GRCm39) missense probably damaging 0.97
R2021:Or4a72 UTSW 2 89,405,305 (GRCm39) missense possibly damaging 0.88
R2030:Or4a72 UTSW 2 89,405,558 (GRCm39) missense probably benign 0.00
R2133:Or4a72 UTSW 2 89,405,600 (GRCm39) nonsense probably null
R3850:Or4a72 UTSW 2 89,405,378 (GRCm39) missense probably damaging 0.99
R4066:Or4a72 UTSW 2 89,405,523 (GRCm39) missense probably damaging 1.00
R4754:Or4a72 UTSW 2 89,405,391 (GRCm39) missense probably benign
R4923:Or4a72 UTSW 2 89,406,023 (GRCm39) missense probably damaging 0.98
R5303:Or4a72 UTSW 2 89,405,345 (GRCm39) missense possibly damaging 0.88
R5574:Or4a72 UTSW 2 89,405,321 (GRCm39) missense possibly damaging 0.94
R6083:Or4a72 UTSW 2 89,406,016 (GRCm39) missense probably benign 0.42
R6188:Or4a72 UTSW 2 89,405,538 (GRCm39) nonsense probably null
R6724:Or4a72 UTSW 2 89,405,309 (GRCm39) missense probably benign 0.26
R6964:Or4a72 UTSW 2 89,405,333 (GRCm39) missense probably benign
R7066:Or4a72 UTSW 2 89,406,047 (GRCm39) missense probably damaging 0.98
R7401:Or4a72 UTSW 2 89,405,449 (GRCm39) missense probably benign 0.27
R8232:Or4a72 UTSW 2 89,405,938 (GRCm39) missense noncoding transcript
R8558:Or4a72 UTSW 2 89,405,329 (GRCm39) missense probably damaging 1.00
R8708:Or4a72 UTSW 2 89,405,623 (GRCm39) missense probably damaging 1.00
R9482:Or4a72 UTSW 2 89,405,953 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGCAATGGACAAGACCACAC -3'
(R):5'- CACTGTTATTGCTAATGGTGGAGC -3'

Sequencing Primer
(F):5'- GACCACACACCCTTTGTTTATAAC -3'
(R):5'- GAGCCATGTGTATTGTGATCTTC -3'
Posted On 2014-08-25