Mutagenetix > Incidental Mutation

Incidental Mutation 'R1992:Dsg2'

223766

Institutional Source

Beutler Lab

Gene Symbol

Dsg2

Ensembl Gene

ENSMUSG00000044393

Gene Name

desmoglein 2

Synonyms

D18Ertd293e

MMRRC Submission

040003-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.233) question?

Stock #

R1992 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

20558074-20604521 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 20601473 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 836 (K836R)

Ref Sequence

ENSEMBL: ENSMUSP00000057096 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059787]

AlphaFold

O55111

Predicted Effect

probably damaging
Transcript: ENSMUST00000059787
AA Change: K836R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000057096
Gene: ENSMUSG00000044393
AA Change: K836R

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
CA	75	162	2.39e-8	SMART
CA	186	275	5.17e-27	SMART
CA	298	392	1.94e-8	SMART
CA	418	502	2.34e-16	SMART
transmembrane domain	618	640	N/A	INTRINSIC
low complexity region	822	838	N/A	INTRINSIC
low complexity region	914	928	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130296

Meta Mutation Damage Score

0.2680

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.5%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Mice lacking the encoded protein die in utero. Mutant mice lacking a part of the extracellular adhesive domain of the encoded protein develop cardiac fibrosis and dilation. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality before somite formation, impaired cell proliferation, and increased apoptosis. Heterozygous mutation of this gene also results in embryonic lethality before somite formation with partial penetrance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 123 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110008L16Rik	A	G	12: 55,338,206	D89G	probably damaging	Het
1600015I10Rik	T	A	6: 48,930,769	H234Q	probably damaging	Het
2310009B15Rik	T	C	1: 138,853,642	T90A	probably damaging	Het
4430402I18Rik	A	G	19: 28,948,624	F130L	probably damaging	Het
4932438A13Rik	A	T	3: 37,000,032	H3100L	probably benign	Het
A930011G23Rik	T	C	5: 99,233,925	D326G	possibly damaging	Het
Abcc2	A	T	19: 43,807,142	I446F	probably damaging	Het
Adamts14	A	G	10: 61,198,660	Y1150H	probably benign	Het
Adgrl2	A	G	3: 148,817,244	I217T	possibly damaging	Het
Afap1l1	A	T	18: 61,741,771	Y446*	probably null	Het
Aimp2	G	A	5: 143,906,730	A14V	probably damaging	Het
Akap8	G	A	17: 32,316,612	H143Y	probably damaging	Het
Aldh2	A	T	5: 121,575,963	V207E	possibly damaging	Het
Armc3	T	C	2: 19,293,142	Y575H	probably damaging	Het
Arpp21	T	C	9: 112,157,793	E230G	probably damaging	Het
Arrdc3	G	A	13: 80,883,689	D14N	probably damaging	Het
Atn1	A	G	6: 124,745,328		probably benign	Het
Atxn7l1	G	A	12: 33,358,744	D302N	probably damaging	Het
Bbs1	T	A	19: 4,891,708	H518L	probably benign	Het
Bmpr1a	C	A	14: 34,425,093	G241C	probably damaging	Het
Cacna1b	G	A	2: 24,732,306	P222L	probably damaging	Het
Calcrl	T	C	2: 84,370,511	Y63C	probably damaging	Het
Cand2	A	G	6: 115,785,132	H173R	possibly damaging	Het
Cap2	T	A	13: 46,637,881	Y175N	possibly damaging	Het
Card14	A	T	11: 119,321,821		probably null	Het
Cd3d	T	A	9: 44,985,001	Y29*	probably null	Het
Cd4	A	G	6: 124,867,688	V378A	possibly damaging	Het
Cluh	A	T	11: 74,660,002	H318L	probably damaging	Het
Clvs1	T	A	4: 9,281,899	D114E	probably benign	Het
Cnot4	T	A	6: 35,023,409	T548S	probably benign	Het
Col18a1	T	C	10: 77,081,154	I114V	unknown	Het
Cr2	G	A	1: 195,154,150	P1278S	possibly damaging	Het
Crebbp	A	T	16: 4,128,697		probably null	Het
D430042O09Rik	A	G	7: 125,820,089	N476S	probably benign	Het
Dnah7a	T	G	1: 53,582,676	K1097Q	possibly damaging	Het
Doc2a	T	A	7: 126,851,807		probably null	Het
Dpp10	A	T	1: 123,905,106	V48E	probably null	Het
Egr2	T	C	10: 67,540,027	V164A	probably damaging	Het
Erbin	A	T	13: 103,833,713	S1132T	probably benign	Het
Espn	T	A	4: 152,128,555		probably null	Het
Fam83b	A	G	9: 76,492,022	S600P	probably benign	Het
Fanca	A	T	8: 123,297,812	N425K	possibly damaging	Het
Flot2	C	T	11: 78,058,619	L294F	probably damaging	Het
Frs2	A	G	10: 117,074,554	V301A	probably benign	Het
Fv1	T	A	4: 147,869,161	N61K	possibly damaging	Het
Fxr2	A	G	11: 69,649,833	E339G	possibly damaging	Het
Gck	T	C	11: 5,906,515	Y214C	probably damaging	Het
Gm4858	G	T	3: 93,074,037	A121S	probably benign	Het
Gm5346	T	C	8: 43,627,139	K16R	probably benign	Het
Gm9573	A	T	17: 35,618,708	S1529T	probably benign	Het
Golga3	C	G	5: 110,192,973	T551R	probably damaging	Het
Gorab	A	G	1: 163,397,056	S59P	probably damaging	Het
Gsdme	C	T	6: 50,208,122	V451M	probably damaging	Het
H2-Bl	A	C	17: 36,081,046	I216S	probably damaging	Het
Herc4	T	A	10: 63,245,964	V22E	possibly damaging	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Hoxa2	A	T	6: 52,164,596	S17T	probably damaging	Het
Hs3st5	A	G	10: 36,832,886	Y139C	probably damaging	Het
Ism1	G	A	2: 139,746,017	V221I	probably benign	Het
Kalrn	T	G	16: 33,975,738	L1222F	probably damaging	Het
Kdm4c	A	G	4: 74,343,394	D602G	possibly damaging	Het
Ktn1	A	G	14: 47,695,521	K711E	probably damaging	Het
Lce1k	A	T	3: 92,806,818	C20S	unknown	Het
Macf1	A	G	4: 123,456,695	S3792P	probably damaging	Het
Maml3	C	T	3: 51,690,757	M189I	probably benign	Het
Mcc	C	A	18: 44,491,315	E213*	probably null	Het
Mep1a	T	G	17: 43,502,682	I13L	probably benign	Het
Mkrn2	G	T	6: 115,609,601	C16F	probably damaging	Het
Mlh1	C	T	9: 111,228,563	A727T	probably damaging	Het
Naa16	T	C	14: 79,356,491	Y344C	probably damaging	Het
Nebl	T	A	2: 17,452,510	I80F	probably damaging	Het
Nlrc4	T	A	17: 74,445,633	Y585F	probably benign	Het
Nrcam	A	G	12: 44,540,970	K149R	probably damaging	Het
Nufip1	T	A	14: 76,134,847	I467N	probably damaging	Het
Nup133	A	G	8: 123,906,221	I1057T	possibly damaging	Het
Obscn	A	T	11: 58,995,827		probably benign	Het
Olfr1113	T	A	2: 87,213,244	C117*	probably null	Het
Olfr173	A	G	16: 58,796,946	V300A	probably benign	Het
Olfr177	A	C	16: 58,872,511	I213R	probably benign	Het
Pi4k2a	A	T	19: 42,115,938	I380F	probably damaging	Het
Piezo2	A	T	18: 63,074,662	L1426Q	probably null	Het
Pik3cg	A	T	12: 32,204,025	D654E	possibly damaging	Het
Poli	G	T	18: 70,508,987	P714Q	probably damaging	Het
Polr3f	A	G	2: 144,536,310	N201D	probably benign	Het
Ptprz1	A	T	6: 22,959,748	K81N	probably benign	Het
Rbm19	T	C	5: 120,133,883		probably null	Het
Sec24a	C	T	11: 51,736,363	V241I	probably benign	Het
Sgk3	A	G	1: 9,880,342	T160A	possibly damaging	Het
Slc1a4	A	G	11: 20,304,375	I497T	probably benign	Het
Slc26a9	A	T	1: 131,762,794	D512V	probably damaging	Het
Slc43a3	C	T	2: 84,957,740	R489C	probably damaging	Het
Slc5a12	T	A	2: 110,621,744	F327L	probably benign	Het
Slitrk3	A	G	3: 73,049,771	V556A	possibly damaging	Het
Spib	T	C	7: 44,528,857	E180G	probably benign	Het
Spint2	T	A	7: 29,259,408	N128Y	probably damaging	Het
Spx	G	A	6: 142,418,519	G102E	probably benign	Het
Spz1	T	A	13: 92,575,658	E103D	possibly damaging	Het
Sstr2	T	C	11: 113,624,669	I138T	probably benign	Het
Sytl3	T	A	17: 6,733,049	I206N	possibly damaging	Het
Tcaf2	T	C	6: 42,629,857	T388A	probably benign	Het
Thap12	T	C	7: 98,716,365	V580A	possibly damaging	Het
Tlr5	T	A	1: 182,974,347	D405E	probably damaging	Het
Tnxb	T	C	17: 34,671,904	V407A	probably damaging	Het
Tpx2	T	A	2: 152,890,624	M606K	probably benign	Het
Trim43a	T	G	9: 88,584,259	L211R	probably damaging	Het
Trim46	A	T	3: 89,237,701	Y489N	probably damaging	Het
Ttc28	C	T	5: 111,276,322	S1485L	probably benign	Het
Ttll8	T	C	15: 88,914,451	T694A	probably benign	Het
Txnl1	T	C	18: 63,679,514	T70A	probably benign	Het
Ube3a	C	T	7: 59,303,787	A823V	probably damaging	Het
Ubqln5	C	A	7: 104,129,534	V28F	probably damaging	Het
Ulk1	T	A	5: 110,787,151	Q972L	probably damaging	Het
Unc93b1	T	C	19: 3,944,062	Y398H	probably benign	Het
Usp1	A	G	4: 98,934,294	D615G	probably benign	Het
Utp15	A	G	13: 98,250,912	C385R	probably benign	Het
Vmn2r91	T	A	17: 18,135,880	V603D	probably damaging	Het
Whamm	C	T	7: 81,591,771	R277*	probably null	Het
Wnt8a	A	G	18: 34,544,884	D115G	probably damaging	Het
Yjefn3	A	T	8: 69,888,995		probably null	Het
Ywhab	A	T	2: 164,011,887	I95F	probably damaging	Het
Zfp143	C	T	7: 110,061,282		probably benign	Het
Zfp607b	C	G	7: 27,702,524	T135R	possibly damaging	Het
Zfp970	A	G	2: 177,474,870	Q79R	possibly damaging	Het

Other mutations in Dsg2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00425:Dsg2	APN	18	20601769	missense	probably benign	0.10
IGL00979:Dsg2	APN	18	20582767	missense	probably damaging	0.99
IGL01081:Dsg2	APN	18	20589942	unclassified	probably benign
IGL01358:Dsg2	APN	18	20601793	missense	probably damaging	0.98
IGL02002:Dsg2	APN	18	20579176	missense	probably damaging	1.00
IGL02263:Dsg2	APN	18	20590020	missense	possibly damaging	0.70
IGL02410:Dsg2	APN	18	20602132	missense	probably benign	0.04
IGL02553:Dsg2	APN	18	20592410	missense	probably damaging	1.00
IGL03036:Dsg2	APN	18	20579077	missense	probably damaging	0.99
dissolute	UTSW	18	20595951	splice site	probably null
Dysjunction	UTSW	18	20582939	nonsense	probably null
weg	UTSW	18	20580651	nonsense	probably null
R0094:Dsg2	UTSW	18	20591853	missense	probably benign	0.08
R0094:Dsg2	UTSW	18	20591853	missense	probably benign	0.08
R0105:Dsg2	UTSW	18	20602054	missense	probably benign	0.03
R0105:Dsg2	UTSW	18	20602054	missense	probably benign	0.03
R0112:Dsg2	UTSW	18	20583042	missense	probably benign	0.02
R0305:Dsg2	UTSW	18	20582695	splice site	probably benign
R0380:Dsg2	UTSW	18	20582939	nonsense	probably null
R0401:Dsg2	UTSW	18	20592508	splice site	probably benign
R0421:Dsg2	UTSW	18	20579391	missense	probably damaging	1.00
R0578:Dsg2	UTSW	18	20594234	missense	probably benign	0.00
R0667:Dsg2	UTSW	18	20573499	missense	possibly damaging	0.50
R1223:Dsg2	UTSW	18	20573493	missense	probably benign	0.23
R1433:Dsg2	UTSW	18	20582723	missense	probably damaging	0.98
R1543:Dsg2	UTSW	18	20594211	missense	probably benign	0.33
R1730:Dsg2	UTSW	18	20591880	missense	probably benign	0.01
R1783:Dsg2	UTSW	18	20591880	missense	probably benign	0.01
R1946:Dsg2	UTSW	18	20580548	missense	probably damaging	1.00
R1991:Dsg2	UTSW	18	20601473	missense	probably damaging	1.00
R2027:Dsg2	UTSW	18	20583004	unclassified	probably benign
R2109:Dsg2	UTSW	18	20592289	missense	probably benign	0.00
R2143:Dsg2	UTSW	18	20579161	missense	probably damaging	1.00
R2201:Dsg2	UTSW	18	20596054	missense	probably damaging	1.00
R2343:Dsg2	UTSW	18	20602298	missense	probably damaging	0.99
R2937:Dsg2	UTSW	18	20579128	missense	probably damaging	1.00
R3710:Dsg2	UTSW	18	20602117	missense	probably damaging	1.00
R3734:Dsg2	UTSW	18	20601947	missense	probably benign	0.41
R3773:Dsg2	UTSW	18	20591862	missense	probably damaging	1.00
R4176:Dsg2	UTSW	18	20580663	missense	probably benign	0.25
R4213:Dsg2	UTSW	18	20598514	missense	probably benign	0.01
R4299:Dsg2	UTSW	18	20595951	splice site	probably null
R4515:Dsg2	UTSW	18	20601387	missense	probably benign
R4649:Dsg2	UTSW	18	20602245	missense	possibly damaging	0.56
R4940:Dsg2	UTSW	18	20579430	missense	probably damaging	1.00
R4949:Dsg2	UTSW	18	20590184	missense	probably damaging	1.00
R4998:Dsg2	UTSW	18	20601521	missense	probably benign	0.26
R5078:Dsg2	UTSW	18	20596083	critical splice donor site	probably null
R5155:Dsg2	UTSW	18	20598658	missense	possibly damaging	0.67
R5398:Dsg2	UTSW	18	20579133	missense	probably benign	0.45
R5503:Dsg2	UTSW	18	20580651	nonsense	probably null
R6133:Dsg2	UTSW	18	20590089	missense	probably benign	0.00
R6163:Dsg2	UTSW	18	20598669	critical splice donor site	probably null
R6226:Dsg2	UTSW	18	20579449	missense	probably damaging	0.98
R6228:Dsg2	UTSW	18	20594293	critical splice donor site	probably null
R6241:Dsg2	UTSW	18	20590217	splice site	probably null
R6482:Dsg2	UTSW	18	20601314	missense	possibly damaging	0.69
R6524:Dsg2	UTSW	18	20583036	missense	probably damaging	1.00
R6856:Dsg2	UTSW	18	20601802	missense	probably damaging	0.98
R7058:Dsg2	UTSW	18	20592275	missense	probably benign	0.00
R7108:Dsg2	UTSW	18	20601863	missense	probably damaging	1.00
R7149:Dsg2	UTSW	18	20579454	missense	probably damaging	0.98
R7207:Dsg2	UTSW	18	20601459	missense	probably damaging	0.99
R7256:Dsg2	UTSW	18	20591931	missense	possibly damaging	0.96
R7315:Dsg2	UTSW	18	20579160	missense	probably damaging	0.97
R7471:Dsg2	UTSW	18	20580618	missense	probably benign	0.08
R7558:Dsg2	UTSW	18	20594234	missense	probably benign	0.00
R8094:Dsg2	UTSW	18	20583004	unclassified	probably benign
R8118:Dsg2	UTSW	18	20582801	missense	probably benign	0.11
R8157:Dsg2	UTSW	18	20580549	missense	probably damaging	1.00
R8307:Dsg2	UTSW	18	20575064	missense	probably benign	0.19
R8308:Dsg2	UTSW	18	20575064	missense	probably benign	0.19
R8488:Dsg2	UTSW	18	20601374	missense	probably damaging	1.00
R8520:Dsg2	UTSW	18	20579451	missense	probably damaging	1.00
R8669:Dsg2	UTSW	18	20590075	missense	probably damaging	1.00
R8675:Dsg2	UTSW	18	20601918	missense	possibly damaging	0.75
R8750:Dsg2	UTSW	18	20575012	missense	possibly damaging	0.90
R8773:Dsg2	UTSW	18	20582999	missense	probably damaging	1.00
R8888:Dsg2	UTSW	18	20590069	missense	probably damaging	1.00
R8895:Dsg2	UTSW	18	20590069	missense	probably damaging	1.00
R8912:Dsg2	UTSW	18	20582821	missense	probably damaging	1.00
R8925:Dsg2	UTSW	18	20592478	missense	probably damaging	1.00
R8927:Dsg2	UTSW	18	20592478	missense	probably damaging	1.00
R9263:Dsg2	UTSW	18	20594166	missense	probably benign	0.33
R9328:Dsg2	UTSW	18	20582790	missense	possibly damaging	0.81
Z1176:Dsg2	UTSW	18	20580621	missense	probably damaging	1.00
Z1177:Dsg2	UTSW	18	20602249	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TTTTGTTTAGAAAGCGGCCTCC -3'
(R):5'- TCTCAGTGACGATTTCCTGTG -3'

Sequencing Primer
(F):5'- GTTTAGAAAGCGGCCTCCTACAATG -3'
(R):5'- CAGTGACGATTTCCTGTGTGACTTTC -3'

Posted On

2014-08-25