Incidental Mutation 'R2020:Tmc2'
ID 223769
Institutional Source Beutler Lab
Gene Symbol Tmc2
Ensembl Gene ENSMUSG00000060332
Gene Name transmembrane channel-like gene family 2
Synonyms
MMRRC Submission 040029-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.267) question?
Stock # R2020 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 130037114-130106365 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 130074305 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 333 (Y333H)
Ref Sequence ENSEMBL: ENSMUSP00000125843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077988] [ENSMUST00000166774]
AlphaFold Q8R4P4
Predicted Effect probably damaging
Transcript: ENSMUST00000077988
AA Change: Y333H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077139
Gene: ENSMUSG00000060332
AA Change: Y333H

DomainStartEndE-ValueType
transmembrane domain 236 258 N/A INTRINSIC
transmembrane domain 317 339 N/A INTRINSIC
transmembrane domain 412 434 N/A INTRINSIC
transmembrane domain 488 507 N/A INTRINSIC
low complexity region 541 553 N/A INTRINSIC
Pfam:TMC 556 671 8.6e-41 PFAM
transmembrane domain 676 698 N/A INTRINSIC
transmembrane domain 735 757 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166774
AA Change: Y333H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125843
Gene: ENSMUSG00000060332
AA Change: Y333H

DomainStartEndE-ValueType
transmembrane domain 236 258 N/A INTRINSIC
transmembrane domain 317 339 N/A INTRINSIC
transmembrane domain 412 434 N/A INTRINSIC
transmembrane domain 488 507 N/A INTRINSIC
low complexity region 541 553 N/A INTRINSIC
Pfam:TMC 556 671 1.2e-36 PFAM
transmembrane domain 676 698 N/A INTRINSIC
transmembrane domain 735 757 N/A INTRINSIC
Meta Mutation Damage Score 0.5911 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.6%
Validation Efficiency 99% (87/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that is necesssary for mechanotransduction in cochlear hair cells of the inner ear. Mutations in this gene may underlie hereditary disorders of balance and hearing. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null allele display normal hearing and motor behavior. Cochlear hair cells show partial resistance to gentamicin induced toxicity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012P17Rik C A 1: 158,796,482 (GRCm39) noncoding transcript Het
Adam17 G A 12: 21,399,876 (GRCm39) R177C probably damaging Het
Ak7 G A 12: 105,711,591 (GRCm39) probably null Het
Akap9 T C 5: 4,011,967 (GRCm39) V890A probably damaging Het
Alg6 A G 4: 99,626,369 (GRCm39) N59S probably damaging Het
Alkbh5 G T 11: 60,429,375 (GRCm39) A43S probably benign Het
Anxa2 C A 9: 69,391,099 (GRCm39) D162E probably damaging Het
Arap1 A G 7: 101,050,725 (GRCm39) H1136R probably benign Het
Arhgap18 A G 10: 26,730,900 (GRCm39) R121G probably benign Het
Arhgef4 A T 1: 34,762,891 (GRCm39) T716S unknown Het
Atg2a T C 19: 6,300,299 (GRCm39) probably null Het
Ccdc27 T C 4: 154,117,770 (GRCm39) I480V probably null Het
Cdipt T C 7: 126,576,105 (GRCm39) V20A possibly damaging Het
Cgrrf1 C T 14: 47,067,902 (GRCm39) probably benign Het
Chd7 G A 4: 8,855,226 (GRCm39) V2152I probably benign Het
Chd8 T A 14: 52,452,698 (GRCm39) S1274C probably damaging Het
Chuk A T 19: 44,095,782 (GRCm39) M17K possibly damaging Het
Col14a1 C T 15: 55,309,577 (GRCm39) probably benign Het
Col20a1 G A 2: 180,654,956 (GRCm39) probably null Het
Cped1 A G 6: 22,143,963 (GRCm39) I570V probably benign Het
Cul9 C G 17: 46,833,101 (GRCm39) A1326P probably damaging Het
Ddx27 A C 2: 166,875,691 (GRCm39) Q674P probably damaging Het
Dennd6a T A 14: 26,333,158 (GRCm39) F131L probably damaging Het
Dhx38 G A 8: 110,283,501 (GRCm39) probably benign Het
Dido1 G T 2: 180,301,378 (GRCm39) N2175K unknown Het
Dmxl1 T A 18: 50,022,625 (GRCm39) Y1654* probably null Het
Dock7 T A 4: 98,847,338 (GRCm39) H1658L probably damaging Het
Dync2h1 T A 9: 7,122,772 (GRCm39) E2061D probably damaging Het
Dync2h1 T C 9: 7,162,925 (GRCm39) I555V probably benign Het
Eif2ak2 T C 17: 79,171,392 (GRCm39) E337G possibly damaging Het
Fabp12 T A 3: 10,315,209 (GRCm39) D46V probably benign Het
Fcgbpl1 T C 7: 27,855,019 (GRCm39) S1882P probably benign Het
Fech C T 18: 64,611,798 (GRCm39) E79K probably damaging Het
Flnc A T 6: 29,444,362 (GRCm39) I693F probably damaging Het
Foxp2 G A 6: 15,324,643 (GRCm39) C97Y possibly damaging Het
Grin2b A G 6: 135,710,894 (GRCm39) M884T probably benign Het
Gtf2ird1 T C 5: 134,445,947 (GRCm39) D28G probably damaging Het
Gtf3c4 C A 2: 28,723,906 (GRCm39) G468W possibly damaging Het
Ift172 A T 5: 31,424,585 (GRCm39) L201* probably null Het
Ift70a1 A G 2: 75,811,279 (GRCm39) V268A probably benign Het
Il1rl2 C A 1: 40,404,374 (GRCm39) S498R probably damaging Het
Ildr1 C T 16: 36,545,903 (GRCm39) R489W probably damaging Het
Itga10 G A 3: 96,559,806 (GRCm39) G487D probably damaging Het
Klk1b8 A G 7: 43,448,640 (GRCm39) N128D probably benign Het
Lgr6 G A 1: 135,003,013 (GRCm39) T79M probably damaging Het
Med6 T C 12: 81,620,651 (GRCm39) T232A probably benign Het
Mgat4e A G 1: 134,469,060 (GRCm39) L328P probably damaging Het
Mttp A G 3: 137,824,163 (GRCm39) Y138H probably damaging Het
Ngef T C 1: 87,473,690 (GRCm39) R31G probably benign Het
Nipsnap2 C A 5: 129,830,287 (GRCm39) probably null Het
Nlgn2 G T 11: 69,719,267 (GRCm39) N194K probably damaging Het
Or1q1 G A 2: 36,887,664 (GRCm39) V281M possibly damaging Het
Or4a72 A T 2: 89,405,305 (GRCm39) M255K possibly damaging Het
Or5b98 G A 19: 12,931,696 (GRCm39) V248I possibly damaging Het
Or5m13b A G 2: 85,754,087 (GRCm39) I158M probably benign Het
Or8c16 A G 9: 38,130,728 (GRCm39) Y203C possibly damaging Het
Pcca T A 14: 123,050,634 (GRCm39) M101K possibly damaging Het
Plekha6 A G 1: 133,212,708 (GRCm39) T671A possibly damaging Het
Prex2 G A 1: 11,232,536 (GRCm39) V868M probably damaging Het
Prkcq G A 2: 11,284,332 (GRCm39) V501I probably benign Het
Prom1 T A 5: 44,168,595 (GRCm39) probably benign Het
Ptprd A G 4: 76,051,398 (GRCm39) V41A probably damaging Het
Rab39 C T 9: 53,597,698 (GRCm39) G189E possibly damaging Het
Ret T C 6: 118,157,343 (GRCm39) K236E possibly damaging Het
Rfx6 G A 10: 51,596,153 (GRCm39) probably null Het
Rnf213 A G 11: 119,352,744 (GRCm39) T3916A probably damaging Het
Rpn1 A G 6: 88,072,665 (GRCm39) N336S probably damaging Het
Sag G A 1: 87,733,037 (GRCm39) A2T probably damaging Het
Sco2 T C 15: 89,256,063 (GRCm39) Y197C probably damaging Het
Sec23b T C 2: 144,408,864 (GRCm39) I183T possibly damaging Het
Sec24b C T 3: 129,781,377 (GRCm39) V1166M probably damaging Het
Slc27a5 A T 7: 12,727,339 (GRCm39) F361Y probably damaging Het
Spaca9 A G 2: 28,586,013 (GRCm39) L17P probably damaging Het
Sqor T C 2: 122,646,027 (GRCm39) probably null Het
Stx18 A G 5: 38,292,588 (GRCm39) H230R probably damaging Het
Tas2r130 A T 6: 131,607,732 (GRCm39) I21N probably damaging Het
Tcaf3 A G 6: 42,570,658 (GRCm39) S365P possibly damaging Het
Tinagl1 G A 4: 130,060,765 (GRCm39) H351Y probably damaging Het
Trp53bp2 A T 1: 182,270,384 (GRCm39) T395S probably damaging Het
Tsc22d1 T C 14: 76,655,773 (GRCm39) S751P probably damaging Het
Ttn A G 2: 76,657,368 (GRCm39) probably benign Het
Ugdh T C 5: 65,574,268 (GRCm39) Y425C probably damaging Het
Vmn1r115 G A 7: 20,578,094 (GRCm39) L273F probably null Het
Vmn2r109 A T 17: 20,761,448 (GRCm39) C636* probably null Het
Vmn2r59 A C 7: 41,693,203 (GRCm39) Y466D probably damaging Het
Zic5 C T 14: 122,702,242 (GRCm39) G163D unknown Het
Other mutations in Tmc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Tmc2 APN 2 130,103,224 (GRCm39) missense possibly damaging 0.94
IGL00966:Tmc2 APN 2 130,105,932 (GRCm39) missense probably benign 0.02
IGL01094:Tmc2 APN 2 130,102,086 (GRCm39) splice site probably benign
IGL01331:Tmc2 APN 2 130,074,276 (GRCm39) missense probably damaging 1.00
IGL01660:Tmc2 APN 2 130,102,144 (GRCm39) nonsense probably null
IGL01926:Tmc2 APN 2 130,102,160 (GRCm39) missense possibly damaging 0.68
IGL02150:Tmc2 APN 2 130,082,073 (GRCm39) missense probably damaging 0.98
IGL02273:Tmc2 APN 2 130,071,126 (GRCm39) missense probably damaging 0.99
IGL03137:Tmc2 APN 2 130,082,050 (GRCm39) missense probably damaging 1.00
IGL03179:Tmc2 APN 2 130,071,107 (GRCm39) missense probably damaging 1.00
FR4449:Tmc2 UTSW 2 130,082,116 (GRCm39) missense probably damaging 1.00
H8786:Tmc2 UTSW 2 130,068,182 (GRCm39) missense probably damaging 1.00
PIT4418001:Tmc2 UTSW 2 130,090,571 (GRCm39) missense probably damaging 0.96
R0364:Tmc2 UTSW 2 130,044,023 (GRCm39) missense probably benign 0.00
R1183:Tmc2 UTSW 2 130,089,896 (GRCm39) missense probably damaging 1.00
R1446:Tmc2 UTSW 2 130,090,650 (GRCm39) missense probably damaging 0.97
R1458:Tmc2 UTSW 2 130,090,682 (GRCm39) missense probably damaging 1.00
R1589:Tmc2 UTSW 2 130,089,880 (GRCm39) missense probably damaging 0.99
R1656:Tmc2 UTSW 2 130,089,854 (GRCm39) missense possibly damaging 0.93
R1686:Tmc2 UTSW 2 130,098,036 (GRCm39) missense possibly damaging 0.71
R1765:Tmc2 UTSW 2 130,102,145 (GRCm39) missense probably benign 0.34
R1776:Tmc2 UTSW 2 130,076,789 (GRCm39) missense probably damaging 1.00
R1873:Tmc2 UTSW 2 130,090,676 (GRCm39) missense possibly damaging 0.68
R1972:Tmc2 UTSW 2 130,056,584 (GRCm39) splice site probably benign
R2208:Tmc2 UTSW 2 130,056,483 (GRCm39) splice site probably null
R3968:Tmc2 UTSW 2 130,043,991 (GRCm39) missense probably benign 0.02
R4732:Tmc2 UTSW 2 130,103,317 (GRCm39) splice site probably null
R4733:Tmc2 UTSW 2 130,103,317 (GRCm39) splice site probably null
R4989:Tmc2 UTSW 2 130,043,961 (GRCm39) missense possibly damaging 0.88
R5143:Tmc2 UTSW 2 130,076,738 (GRCm39) missense probably damaging 0.98
R5411:Tmc2 UTSW 2 130,082,035 (GRCm39) missense probably damaging 1.00
R5514:Tmc2 UTSW 2 130,083,564 (GRCm39) missense possibly damaging 0.94
R5690:Tmc2 UTSW 2 130,074,306 (GRCm39) missense probably damaging 1.00
R5983:Tmc2 UTSW 2 130,089,896 (GRCm39) missense probably damaging 1.00
R6451:Tmc2 UTSW 2 130,106,123 (GRCm39) missense probably damaging 0.99
R6927:Tmc2 UTSW 2 130,103,300 (GRCm39) missense probably benign
R7132:Tmc2 UTSW 2 130,074,329 (GRCm39) missense possibly damaging 0.82
R7240:Tmc2 UTSW 2 130,076,724 (GRCm39) missense possibly damaging 0.80
R7353:Tmc2 UTSW 2 130,038,497 (GRCm39) critical splice donor site probably null
R8167:Tmc2 UTSW 2 130,083,488 (GRCm39) missense probably benign 0.04
R8554:Tmc2 UTSW 2 130,106,084 (GRCm39) missense probably benign 0.00
R9134:Tmc2 UTSW 2 130,074,321 (GRCm39) missense probably benign 0.21
R9169:Tmc2 UTSW 2 130,083,516 (GRCm39) missense probably damaging 1.00
R9209:Tmc2 UTSW 2 130,103,317 (GRCm39) splice site probably null
R9232:Tmc2 UTSW 2 130,085,049 (GRCm39) missense probably damaging 1.00
R9725:Tmc2 UTSW 2 130,089,881 (GRCm39) missense probably damaging 0.99
X0019:Tmc2 UTSW 2 130,050,205 (GRCm39) missense possibly damaging 0.59
X0052:Tmc2 UTSW 2 130,043,892 (GRCm39) missense probably benign 0.00
Z1177:Tmc2 UTSW 2 130,050,216 (GRCm39) missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- TTGGGACTCTTCCTCTGTAGAC -3'
(R):5'- TCTCAGGAAAGTACACACAGAG -3'

Sequencing Primer
(F):5'- GTAGACCTGCTTTAAAACTCAGACAG -3'
(R):5'- CTCAGGAAAGTACACACAGAGGAGTC -3'
Posted On 2014-08-25