Incidental Mutation 'R2020:Ddx27'
ID223773
Institutional Source Beutler Lab
Gene Symbol Ddx27
Ensembl Gene ENSMUSG00000017999
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 27
Synonyms
MMRRC Submission 040029-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R2020 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location167015193-167034947 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 167033771 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Proline at position 674 (Q674P)
Ref Sequence ENSEMBL: ENSMUSP00000018143 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018143] [ENSMUST00000048988] [ENSMUST00000067584]
Predicted Effect probably damaging
Transcript: ENSMUST00000018143
AA Change: Q674P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000018143
Gene: ENSMUSG00000017999
AA Change: Q674P

DomainStartEndE-ValueType
low complexity region 20 33 N/A INTRINSIC
coiled coil region 78 106 N/A INTRINSIC
low complexity region 133 148 N/A INTRINSIC
low complexity region 157 166 N/A INTRINSIC
DEXDc 203 404 2.24e-56 SMART
HELICc 443 524 1.71e-29 SMART
coiled coil region 577 613 N/A INTRINSIC
low complexity region 622 629 N/A INTRINSIC
low complexity region 644 657 N/A INTRINSIC
low complexity region 679 692 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000048988
SMART Domains Protein: ENSMUSP00000049404
Gene: ENSMUSG00000039501

DomainStartEndE-ValueType
Pfam:AAA_11 590 855 2.2e-17 PFAM
Pfam:AAA_19 597 684 1.7e-10 PFAM
Pfam:AAA_11 829 1033 1.4e-18 PFAM
Pfam:AAA_12 1044 1228 3.7e-42 PFAM
internal_repeat_2 1281 1374 1.33e-7 PROSPERO
internal_repeat_1 1292 1410 1.32e-16 PROSPERO
low complexity region 1422 1433 N/A INTRINSIC
internal_repeat_1 1434 1547 1.32e-16 PROSPERO
internal_repeat_2 1453 1555 1.33e-7 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000067584
SMART Domains Protein: ENSMUSP00000072867
Gene: ENSMUSG00000039501

DomainStartEndE-ValueType
Pfam:AAA_11 8 170 1.2e-17 PFAM
Pfam:AAA_12 180 364 7.4e-42 PFAM
internal_repeat_2 417 510 1.08e-6 PROSPERO
internal_repeat_1 428 546 1.81e-14 PROSPERO
low complexity region 558 569 N/A INTRINSIC
internal_repeat_1 570 683 1.81e-14 PROSPERO
internal_repeat_2 589 691 1.08e-6 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127468
Meta Mutation Damage Score 0.1716 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.6%
Validation Efficiency 99% (87/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein involved in the processing of 5.8S and 28S ribosomal RNAs. More specifically, the encoded protein localizes to the nucleolus, where it interacts with the PeBoW complex to ensure proper 3' end formation of 47S rRNA. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012P17Rik C A 1: 158,968,912 noncoding transcript Het
9530053A07Rik T C 7: 28,155,594 S1882P probably benign Het
Adam17 G A 12: 21,349,875 R177C probably damaging Het
Ak7 G A 12: 105,745,332 probably null Het
Akap9 T C 5: 3,961,967 V890A probably damaging Het
Alg6 A G 4: 99,738,132 N59S probably damaging Het
Alkbh5 G T 11: 60,538,549 A43S probably benign Het
Anxa2 C A 9: 69,483,817 D162E probably damaging Het
Arap1 A G 7: 101,401,518 H1136R probably benign Het
Arhgap18 A G 10: 26,854,904 R121G probably benign Het
Arhgef4 A T 1: 34,723,810 T716S unknown Het
Atg2a T C 19: 6,250,269 probably null Het
Ccdc27 T C 4: 154,033,313 I480V probably null Het
Cdipt T C 7: 126,976,933 V20A possibly damaging Het
Cgrrf1 C T 14: 46,830,445 probably benign Het
Chd7 G A 4: 8,855,226 V2152I probably benign Het
Chd8 T A 14: 52,215,241 S1274C probably damaging Het
Chuk A T 19: 44,107,343 M17K possibly damaging Het
Col14a1 C T 15: 55,446,181 probably benign Het
Col20a1 G A 2: 181,013,163 probably null Het
Cped1 A G 6: 22,143,964 I570V probably benign Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Dennd6a T A 14: 26,612,003 F131L probably damaging Het
Dhx38 G A 8: 109,556,869 probably benign Het
Dido1 G T 2: 180,659,585 N2175K unknown Het
Dmxl1 T A 18: 49,889,558 Y1654* probably null Het
Dock7 T A 4: 98,959,101 H1658L probably damaging Het
Dync2h1 T A 9: 7,122,772 E2061D probably damaging Het
Dync2h1 T C 9: 7,162,925 I555V probably benign Het
Eif2ak2 T C 17: 78,863,963 E337G possibly damaging Het
Fabp12 T A 3: 10,250,149 D46V probably benign Het
Fech C T 18: 64,478,727 E79K probably damaging Het
Flnc A T 6: 29,444,363 I693F probably damaging Het
Foxp2 G A 6: 15,324,644 C97Y possibly damaging Het
Grin2b A G 6: 135,733,896 M884T probably benign Het
Gtf2ird1 T C 5: 134,417,093 D28G probably damaging Het
Gtf3c4 C A 2: 28,833,894 G468W possibly damaging Het
Ift172 A T 5: 31,267,241 L201* probably null Het
Il1rl2 C A 1: 40,365,214 S498R probably damaging Het
Ildr1 C T 16: 36,725,541 R489W probably damaging Het
Itga10 G A 3: 96,652,490 G487D probably damaging Het
Klk8 A G 7: 43,799,216 N128D probably benign Het
Lgr6 G A 1: 135,075,275 T79M probably damaging Het
Med6 T C 12: 81,573,877 T232A probably benign Het
Mgat4e A G 1: 134,541,322 L328P probably damaging Het
Mttp A G 3: 138,118,402 Y138H probably damaging Het
Ngef T C 1: 87,545,968 R31G probably benign Het
Nipsnap2 C A 5: 129,753,223 probably null Het
Nlgn2 G T 11: 69,828,441 N194K probably damaging Het
Olfr1026 A G 2: 85,923,743 I158M probably benign Het
Olfr1245 A T 2: 89,574,961 M255K possibly damaging Het
Olfr1450 G A 19: 12,954,332 V248I possibly damaging Het
Olfr357 G A 2: 36,997,652 V281M possibly damaging Het
Olfr894 A G 9: 38,219,432 Y203C possibly damaging Het
Pcca T A 14: 122,813,222 M101K possibly damaging Het
Plekha6 A G 1: 133,284,970 T671A possibly damaging Het
Prex2 G A 1: 11,162,312 V868M probably damaging Het
Prkcq G A 2: 11,279,521 V501I probably benign Het
Prom1 T A 5: 44,011,253 probably benign Het
Ptprd A G 4: 76,133,161 V41A probably damaging Het
Rab39 C T 9: 53,686,398 G189E possibly damaging Het
Ret T C 6: 118,180,382 K236E possibly damaging Het
Rfx6 G A 10: 51,720,057 probably null Het
Rnf213 A G 11: 119,461,918 T3916A probably damaging Het
Rpn1 A G 6: 88,095,683 N336S probably damaging Het
Sag G A 1: 87,805,315 A2T probably damaging Het
Sco2 T C 15: 89,371,860 Y197C probably damaging Het
Sec23b T C 2: 144,566,944 I183T possibly damaging Het
Sec24b C T 3: 129,987,728 V1166M probably damaging Het
Slc27a5 A T 7: 12,993,412 F361Y probably damaging Het
Spaca9 A G 2: 28,696,001 L17P probably damaging Het
Sqor T C 2: 122,804,107 probably null Het
Stx18 A G 5: 38,135,244 H230R probably damaging Het
Tas2r130 A T 6: 131,630,769 I21N probably damaging Het
Tcaf3 A G 6: 42,593,724 S365P possibly damaging Het
Tinagl1 G A 4: 130,166,972 H351Y probably damaging Het
Tmc2 T C 2: 130,232,385 Y333H probably damaging Het
Trp53bp2 A T 1: 182,442,819 T395S probably damaging Het
Tsc22d1 T C 14: 76,418,333 S751P probably damaging Het
Ttc30a1 A G 2: 75,980,935 V268A probably benign Het
Ttn A G 2: 76,827,024 probably benign Het
Ugdh T C 5: 65,416,925 Y425C probably damaging Het
Vmn1r115 G A 7: 20,844,169 L273F probably null Het
Vmn2r109 A T 17: 20,541,186 C636* probably null Het
Vmn2r59 A C 7: 42,043,779 Y466D probably damaging Het
Zic5 C T 14: 122,464,830 G163D unknown Het
Other mutations in Ddx27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Ddx27 APN 2 167019966 missense probably benign 0.00
IGL01610:Ddx27 APN 2 167022044 splice site probably benign
IGL01724:Ddx27 APN 2 167028389 missense probably damaging 1.00
IGL02035:Ddx27 APN 2 167029512 missense probably benign 0.00
IGL02141:Ddx27 APN 2 167020523 missense possibly damaging 0.67
IGL02402:Ddx27 APN 2 167015325 utr 5 prime probably benign
IGL02600:Ddx27 APN 2 167026204 missense probably damaging 1.00
IGL02882:Ddx27 APN 2 167027913 missense possibly damaging 0.86
IGL03177:Ddx27 APN 2 167027920 missense possibly damaging 0.76
R1938:Ddx27 UTSW 2 167034109 missense probably damaging 1.00
R2038:Ddx27 UTSW 2 167033755 missense probably damaging 1.00
R2116:Ddx27 UTSW 2 167027764 missense probably benign 0.23
R3103:Ddx27 UTSW 2 167026246 missense probably damaging 1.00
R4524:Ddx27 UTSW 2 167027720 nonsense probably null
R4586:Ddx27 UTSW 2 167019984 missense probably benign 0.00
R4737:Ddx27 UTSW 2 167029299 missense probably benign 0.37
R5350:Ddx27 UTSW 2 167027860 unclassified probably benign
R5568:Ddx27 UTSW 2 167029519 missense possibly damaging 0.78
R5573:Ddx27 UTSW 2 167017886 missense possibly damaging 0.87
R5606:Ddx27 UTSW 2 167019966 missense probably benign 0.00
R6026:Ddx27 UTSW 2 167033640 missense probably benign 0.00
R6699:Ddx27 UTSW 2 167020503 missense possibly damaging 0.92
R6845:Ddx27 UTSW 2 167022096 missense probably damaging 1.00
R6941:Ddx27 UTSW 2 167015377 missense possibly damaging 0.93
R7352:Ddx27 UTSW 2 167029513 missense probably benign 0.03
R7765:Ddx27 UTSW 2 167027959 missense probably damaging 1.00
Z1177:Ddx27 UTSW 2 167033841 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGTTGCTAAGGCTCTACAGGAG -3'
(R):5'- GGGCCAGGTTCAAGGATACATC -3'

Sequencing Primer
(F):5'- CTAAGGCTCTACAGGAGTTTGAC -3'
(R):5'- GGATACATCCCAGTTCCTCCAAAG -3'
Posted On2014-08-25