Mutagenetix > Incidental Mutation

Incidental Mutation 'R2020:Dido1'

223775

Institutional Source

Beutler Lab

Gene Symbol

Dido1

Ensembl Gene

ENSMUSG00000038914

Gene Name

death inducer-obliterator 1

Synonyms

6720461J16Rik, DIO-1, Datf1, D130048F08Rik

MMRRC Submission

040029-MU

Accession Numbers

Genbank: NM_175551; MGI: 1344352

Essential gene?

Probably essential (E-score: 0.958) question?

Stock #

R2020 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

180657964-180709999 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 180659585 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 2175 (N2175K)

Ref Sequence

ENSEMBL: ENSMUSP00000084794 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087517]

AlphaFold

Q8C9B9

Predicted Effect

unknown
Transcript: ENSMUST00000087517
AA Change: N2175K

SMART Domains

Protein: ENSMUSP00000084794
Gene: ENSMUSG00000038914
AA Change: N2175K

Domain	Start	End	E-Value	Type
low complexity region	134	155	N/A	INTRINSIC
PHD	267	317	1.19e-11	SMART
low complexity region	430	446	N/A	INTRINSIC
TFS2M	669	770	1.16e-45	SMART
low complexity region	937	962	N/A	INTRINSIC
low complexity region	1023	1037	N/A	INTRINSIC
Pfam:SPOC	1052	1158	1e-22	PFAM
low complexity region	1253	1267	N/A	INTRINSIC
low complexity region	1279	1308	N/A	INTRINSIC
low complexity region	1372	1391	N/A	INTRINSIC
coiled coil region	1458	1502	N/A	INTRINSIC
low complexity region	1649	1680	N/A	INTRINSIC
low complexity region	1748	1766	N/A	INTRINSIC
low complexity region	1780	1792	N/A	INTRINSIC
low complexity region	1804	1815	N/A	INTRINSIC
internal_repeat_2	1816	1852	3.9e-5	PROSPERO
internal_repeat_1	1819	1859	6.92e-7	PROSPERO
internal_repeat_2	1926	1964	3.9e-5	PROSPERO
internal_repeat_1	1940	1982	6.92e-7	PROSPERO
low complexity region	2025	2045	N/A	INTRINSIC
low complexity region	2123	2160	N/A	INTRINSIC
low complexity region	2163	2177	N/A	INTRINSIC
low complexity region	2182	2239	N/A	INTRINSIC

Meta Mutation Damage Score

0.0869

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 93.6%

Validation Efficiency

99% (87/88)

MGI Phenotype

FUNCTION: This gene encodes a transcription factor involved in apoptosis. The encoded protein functions in cell cycle progression and plays a role in chromosomal stability. This protein regulates the self-renewal of embryonic stem cells. Disruption of this gene in mice causes symptoms similar to myelodysplastic/myeloproliferative diseases in humans. Mice lacking this gene show severely reduced fertility. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit severely reduced fertility; about one-half develop a transplantable disease characterized by anomalies in spleen, bone marrow, and peripheral blood and including anemia and various symptoms typical of myeloid dysplasia or myeloid proliferation. [provided by MGI curators]

Allele List at MGI

All alleles(245) : Targeted, knock-out(1) Gene trapped(244)

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600012P17Rik	C	A	1: 158,968,912		noncoding transcript	Het
9530053A07Rik	T	C	7: 28,155,594	S1882P	probably benign	Het
Adam17	G	A	12: 21,349,875	R177C	probably damaging	Het
Ak7	G	A	12: 105,745,332		probably null	Het
Akap9	T	C	5: 3,961,967	V890A	probably damaging	Het
Alg6	A	G	4: 99,738,132	N59S	probably damaging	Het
Alkbh5	G	T	11: 60,538,549	A43S	probably benign	Het
Anxa2	C	A	9: 69,483,817	D162E	probably damaging	Het
Arap1	A	G	7: 101,401,518	H1136R	probably benign	Het
Arhgap18	A	G	10: 26,854,904	R121G	probably benign	Het
Arhgef4	A	T	1: 34,723,810	T716S	unknown	Het
Atg2a	T	C	19: 6,250,269		probably null	Het
Ccdc27	T	C	4: 154,033,313	I480V	probably null	Het
Cdipt	T	C	7: 126,976,933	V20A	possibly damaging	Het
Cgrrf1	C	T	14: 46,830,445		probably benign	Het
Chd7	G	A	4: 8,855,226	V2152I	probably benign	Het
Chd8	T	A	14: 52,215,241	S1274C	probably damaging	Het
Chuk	A	T	19: 44,107,343	M17K	possibly damaging	Het
Col14a1	C	T	15: 55,446,181		probably benign	Het
Col20a1	G	A	2: 181,013,163		probably null	Het
Cped1	A	G	6: 22,143,964	I570V	probably benign	Het
Cul9	C	G	17: 46,522,175	A1326P	probably damaging	Het
Ddx27	A	C	2: 167,033,771	Q674P	probably damaging	Het
Dennd6a	T	A	14: 26,612,003	F131L	probably damaging	Het
Dhx38	G	A	8: 109,556,869		probably benign	Het
Dmxl1	T	A	18: 49,889,558	Y1654*	probably null	Het
Dock7	T	A	4: 98,959,101	H1658L	probably damaging	Het
Dync2h1	T	A	9: 7,122,772	E2061D	probably damaging	Het
Dync2h1	T	C	9: 7,162,925	I555V	probably benign	Het
Eif2ak2	T	C	17: 78,863,963	E337G	possibly damaging	Het
Fabp12	T	A	3: 10,250,149	D46V	probably benign	Het
Fech	C	T	18: 64,478,727	E79K	probably damaging	Het
Flnc	A	T	6: 29,444,363	I693F	probably damaging	Het
Foxp2	G	A	6: 15,324,644	C97Y	possibly damaging	Het
Grin2b	A	G	6: 135,733,896	M884T	probably benign	Het
Gtf2ird1	T	C	5: 134,417,093	D28G	probably damaging	Het
Gtf3c4	C	A	2: 28,833,894	G468W	possibly damaging	Het
Ift172	A	T	5: 31,267,241	L201*	probably null	Het
Il1rl2	C	A	1: 40,365,214	S498R	probably damaging	Het
Ildr1	C	T	16: 36,725,541	R489W	probably damaging	Het
Itga10	G	A	3: 96,652,490	G487D	probably damaging	Het
Klk8	A	G	7: 43,799,216	N128D	probably benign	Het
Lgr6	G	A	1: 135,075,275	T79M	probably damaging	Het
Med6	T	C	12: 81,573,877	T232A	probably benign	Het
Mgat4e	A	G	1: 134,541,322	L328P	probably damaging	Het
Mttp	A	G	3: 138,118,402	Y138H	probably damaging	Het
Ngef	T	C	1: 87,545,968	R31G	probably benign	Het
Nipsnap2	C	A	5: 129,753,223		probably null	Het
Nlgn2	G	T	11: 69,828,441	N194K	probably damaging	Het
Olfr1026	A	G	2: 85,923,743	I158M	probably benign	Het
Olfr1245	A	T	2: 89,574,961	M255K	possibly damaging	Het
Olfr1450	G	A	19: 12,954,332	V248I	possibly damaging	Het
Olfr357	G	A	2: 36,997,652	V281M	possibly damaging	Het
Olfr894	A	G	9: 38,219,432	Y203C	possibly damaging	Het
Pcca	T	A	14: 122,813,222	M101K	possibly damaging	Het
Plekha6	A	G	1: 133,284,970	T671A	possibly damaging	Het
Prex2	G	A	1: 11,162,312	V868M	probably damaging	Het
Prkcq	G	A	2: 11,279,521	V501I	probably benign	Het
Prom1	T	A	5: 44,011,253		probably benign	Het
Ptprd	A	G	4: 76,133,161	V41A	probably damaging	Het
Rab39	C	T	9: 53,686,398	G189E	possibly damaging	Het
Ret	T	C	6: 118,180,382	K236E	possibly damaging	Het
Rfx6	G	A	10: 51,720,057		probably null	Het
Rnf213	A	G	11: 119,461,918	T3916A	probably damaging	Het
Rpn1	A	G	6: 88,095,683	N336S	probably damaging	Het
Sag	G	A	1: 87,805,315	A2T	probably damaging	Het
Sco2	T	C	15: 89,371,860	Y197C	probably damaging	Het
Sec23b	T	C	2: 144,566,944	I183T	possibly damaging	Het
Sec24b	C	T	3: 129,987,728	V1166M	probably damaging	Het
Slc27a5	A	T	7: 12,993,412	F361Y	probably damaging	Het
Spaca9	A	G	2: 28,696,001	L17P	probably damaging	Het
Sqor	T	C	2: 122,804,107		probably null	Het
Stx18	A	G	5: 38,135,244	H230R	probably damaging	Het
Tas2r130	A	T	6: 131,630,769	I21N	probably damaging	Het
Tcaf3	A	G	6: 42,593,724	S365P	possibly damaging	Het
Tinagl1	G	A	4: 130,166,972	H351Y	probably damaging	Het
Tmc2	T	C	2: 130,232,385	Y333H	probably damaging	Het
Trp53bp2	A	T	1: 182,442,819	T395S	probably damaging	Het
Tsc22d1	T	C	14: 76,418,333	S751P	probably damaging	Het
Ttc30a1	A	G	2: 75,980,935	V268A	probably benign	Het
Ttn	A	G	2: 76,827,024		probably benign	Het
Ugdh	T	C	5: 65,416,925	Y425C	probably damaging	Het
Vmn1r115	G	A	7: 20,844,169	L273F	probably null	Het
Vmn2r109	A	T	17: 20,541,186	C636*	probably null	Het
Vmn2r59	A	C	7: 42,043,779	Y466D	probably damaging	Het
Zic5	C	T	14: 122,464,830	G163D	unknown	Het

Other mutations in Dido1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00425:Dido1	APN	2	180683989	missense	probably benign
IGL00834:Dido1	APN	2	180689526	missense	possibly damaging	0.87
IGL01317:Dido1	APN	2	180671757	missense	probably benign	0.17
IGL01588:Dido1	APN	2	180688875	missense	probably benign	0.00
IGL01834:Dido1	APN	2	180684031	splice site	probably benign
IGL02102:Dido1	APN	2	180662247	missense	possibly damaging	0.58
IGL02556:Dido1	APN	2	180689335	missense	possibly damaging	0.69
IGL02756:Dido1	APN	2	180661923	missense	probably benign	0.00
IGL02826:Dido1	APN	2	180683958	missense	probably benign
IGL02970:Dido1	APN	2	180689415	missense	probably damaging	0.99
IGL03110:Dido1	APN	2	180689342	missense	probably damaging	1.00
IGL03116:Dido1	APN	2	180670979	missense	probably damaging	1.00
3370:Dido1	UTSW	2	180671542	missense	probably benign
A4554:Dido1	UTSW	2	180675371	missense	probably damaging	1.00
H8441:Dido1	UTSW	2	180689014	missense	probably benign	0.12
R0044:Dido1	UTSW	2	180661819	missense	probably damaging	1.00
R0044:Dido1	UTSW	2	180661819	missense	probably damaging	1.00
R0054:Dido1	UTSW	2	180661474	missense	probably benign	0.00
R0054:Dido1	UTSW	2	180661474	missense	probably benign	0.00
R0127:Dido1	UTSW	2	180671824	missense	probably benign	0.01
R0620:Dido1	UTSW	2	180659851	missense	probably benign	0.26
R0734:Dido1	UTSW	2	180660042	missense	probably benign	0.01
R1390:Dido1	UTSW	2	180685124	missense	possibly damaging	0.70
R1445:Dido1	UTSW	2	180671470	missense	possibly damaging	0.62
R1466:Dido1	UTSW	2	180662328	missense	probably damaging	1.00
R1466:Dido1	UTSW	2	180662328	missense	probably damaging	1.00
R1472:Dido1	UTSW	2	180660720	missense	probably benign	0.02
R1538:Dido1	UTSW	2	180684970	missense	possibly damaging	0.49
R1584:Dido1	UTSW	2	180662328	missense	probably damaging	1.00
R2025:Dido1	UTSW	2	180689181	nonsense	probably null
R2026:Dido1	UTSW	2	180689181	nonsense	probably null
R2027:Dido1	UTSW	2	180689181	nonsense	probably null
R2089:Dido1	UTSW	2	180661884	missense	probably benign	0.29
R2091:Dido1	UTSW	2	180661884	missense	probably benign	0.29
R2091:Dido1	UTSW	2	180661884	missense	probably benign	0.29
R2495:Dido1	UTSW	2	180689388	missense	probably benign	0.00
R2931:Dido1	UTSW	2	180661653	missense	probably damaging	1.00
R3418:Dido1	UTSW	2	180660935	missense	possibly damaging	0.84
R3735:Dido1	UTSW	2	180684036	splice site	probably benign
R4523:Dido1	UTSW	2	180672292	missense	probably damaging	1.00
R4674:Dido1	UTSW	2	180687559	missense	probably damaging	0.97
R4729:Dido1	UTSW	2	180687650	missense	probably benign	0.00
R4762:Dido1	UTSW	2	180689575	missense	probably damaging	1.00
R4786:Dido1	UTSW	2	180670871	missense	possibly damaging	0.85
R4817:Dido1	UTSW	2	180661416	missense	probably benign	0.02
R4892:Dido1	UTSW	2	180675029	nonsense	probably null
R4979:Dido1	UTSW	2	180660813	missense	probably damaging	0.98
R5510:Dido1	UTSW	2	180685173	missense	probably benign	0.00
R5586:Dido1	UTSW	2	180659652	nonsense	probably null
R5672:Dido1	UTSW	2	180671903	missense	probably damaging	0.99
R5863:Dido1	UTSW	2	180661773	missense	probably benign	0.02
R5943:Dido1	UTSW	2	180661882	missense	probably benign	0.00
R5974:Dido1	UTSW	2	180671497	missense	probably benign	0.02
R6123:Dido1	UTSW	2	180683967	missense	probably benign	0.07
R6214:Dido1	UTSW	2	180662152	missense	probably damaging	1.00
R6215:Dido1	UTSW	2	180662152	missense	probably damaging	1.00
R6248:Dido1	UTSW	2	180660255	missense	probably damaging	1.00
R6285:Dido1	UTSW	2	180661147	missense	probably benign	0.00
R6349:Dido1	UTSW	2	180660701	missense	probably benign	0.03
R6437:Dido1	UTSW	2	180675013	missense	probably damaging	1.00
R6477:Dido1	UTSW	2	180660481	missense	probably benign	0.00
R6836:Dido1	UTSW	2	180662307	missense	probably benign	0.16
R7055:Dido1	UTSW	2	180661209	missense	probably benign	0.09
R7289:Dido1	UTSW	2	180659631	missense	unknown
R7304:Dido1	UTSW	2	180687493	missense	probably damaging	1.00
R7343:Dido1	UTSW	2	180675121	missense	possibly damaging	0.49
R7363:Dido1	UTSW	2	180662517	nonsense	probably null
R7429:Dido1	UTSW	2	180689526	missense	possibly damaging	0.87
R7594:Dido1	UTSW	2	180675112	missense	probably benign
R7629:Dido1	UTSW	2	180661473	missense	probably benign
R7899:Dido1	UTSW	2	180671597	missense	possibly damaging	0.82
R7946:Dido1	UTSW	2	180661708	missense	possibly damaging	0.81
R7951:Dido1	UTSW	2	180670881	missense	probably benign	0.01
R8033:Dido1	UTSW	2	180674842	missense	probably damaging	1.00
R8069:Dido1	UTSW	2	180660912	missense	probably benign
R8331:Dido1	UTSW	2	180660449	missense	probably benign	0.00
R8479:Dido1	UTSW	2	180673229	critical splice donor site	probably null
R8936:Dido1	UTSW	2	180661402	missense	probably benign
R9089:Dido1	UTSW	2	180661500	missense	probably benign	0.00
R9647:Dido1	UTSW	2	180673275	missense	probably benign	0.00
R9648:Dido1	UTSW	2	180660675	missense	probably damaging	1.00
R9784:Dido1	UTSW	2	180683561	missense	probably benign	0.27
V1024:Dido1	UTSW	2	180689014	missense	probably benign	0.12
X0011:Dido1	UTSW	2	180660834	missense	probably benign	0.00
X0019:Dido1	UTSW	2	180671572	missense	possibly damaging	0.62

Predicted Primers

PCR Primer
(F):5'- ACACAGGTCTTTGTCCACACC -3'
(R):5'- AGAAAAGCCTCTGGACGAGC -3'

Sequencing Primer
(F):5'- AGGTCTTTGTCCACACCAGCAG -3'
(R):5'- AGCCTGAAGCCCAAGGGTTG -3'

Posted On

2014-08-25