Incidental Mutation 'R2020:Col20a1'
ID 223777
Institutional Source Beutler Lab
Gene Symbol Col20a1
Ensembl Gene ENSMUSG00000016356
Gene Name collagen, type XX, alpha 1
Synonyms 1700051I12Rik
MMRRC Submission 040029-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2020 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 180628328-180660156 bp(+) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 180654956 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108856] [ENSMUST00000149179] [ENSMUST00000228434]
AlphaFold Q923P0
Predicted Effect probably null
Transcript: ENSMUST00000108856
SMART Domains Protein: ENSMUSP00000104484
Gene: ENSMUSG00000016356

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FN3 24 103 2.18e1 SMART
VWA 175 354 4.68e-55 SMART
FN3 375 453 6.2e-7 SMART
FN3 464 543 7.34e-9 SMART
FN3 555 633 8.18e-7 SMART
FN3 644 723 8.98e-4 SMART
FN3 738 817 1.43e-11 SMART
TSPN 840 1035 6.45e-31 SMART
Pfam:Collagen 1067 1125 3.8e-9 PFAM
Pfam:Collagen 1122 1174 7.4e-9 PFAM
Pfam:Collagen 1165 1223 3e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149179
SMART Domains Protein: ENSMUSP00000115291
Gene: ENSMUSG00000016356

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FN3 24 103 2.18e1 SMART
VWA 175 354 4.68e-55 SMART
FN3 375 453 6.2e-7 SMART
FN3 464 543 7.34e-9 SMART
FN3 555 633 8.18e-7 SMART
FN3 644 723 8.98e-4 SMART
FN3 738 817 1.43e-11 SMART
TSPN 840 1035 6.45e-31 SMART
low complexity region 1069 1106 N/A INTRINSIC
low complexity region 1108 1121 N/A INTRINSIC
low complexity region 1136 1155 N/A INTRINSIC
Blast:TSPN 1156 1202 2e-19 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000155425
SMART Domains Protein: ENSMUSP00000114654
Gene: ENSMUSG00000016356

DomainStartEndE-ValueType
Pfam:Collagen 1 55 4.9e-12 PFAM
Pfam:Collagen 36 94 2.2e-13 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000228434
Meta Mutation Damage Score 0.8603 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.6%
Validation Efficiency 99% (87/88)
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012P17Rik C A 1: 158,796,482 (GRCm39) noncoding transcript Het
Adam17 G A 12: 21,399,876 (GRCm39) R177C probably damaging Het
Ak7 G A 12: 105,711,591 (GRCm39) probably null Het
Akap9 T C 5: 4,011,967 (GRCm39) V890A probably damaging Het
Alg6 A G 4: 99,626,369 (GRCm39) N59S probably damaging Het
Alkbh5 G T 11: 60,429,375 (GRCm39) A43S probably benign Het
Anxa2 C A 9: 69,391,099 (GRCm39) D162E probably damaging Het
Arap1 A G 7: 101,050,725 (GRCm39) H1136R probably benign Het
Arhgap18 A G 10: 26,730,900 (GRCm39) R121G probably benign Het
Arhgef4 A T 1: 34,762,891 (GRCm39) T716S unknown Het
Atg2a T C 19: 6,300,299 (GRCm39) probably null Het
Ccdc27 T C 4: 154,117,770 (GRCm39) I480V probably null Het
Cdipt T C 7: 126,576,105 (GRCm39) V20A possibly damaging Het
Cgrrf1 C T 14: 47,067,902 (GRCm39) probably benign Het
Chd7 G A 4: 8,855,226 (GRCm39) V2152I probably benign Het
Chd8 T A 14: 52,452,698 (GRCm39) S1274C probably damaging Het
Chuk A T 19: 44,095,782 (GRCm39) M17K possibly damaging Het
Col14a1 C T 15: 55,309,577 (GRCm39) probably benign Het
Cped1 A G 6: 22,143,963 (GRCm39) I570V probably benign Het
Cul9 C G 17: 46,833,101 (GRCm39) A1326P probably damaging Het
Ddx27 A C 2: 166,875,691 (GRCm39) Q674P probably damaging Het
Dennd6a T A 14: 26,333,158 (GRCm39) F131L probably damaging Het
Dhx38 G A 8: 110,283,501 (GRCm39) probably benign Het
Dido1 G T 2: 180,301,378 (GRCm39) N2175K unknown Het
Dmxl1 T A 18: 50,022,625 (GRCm39) Y1654* probably null Het
Dock7 T A 4: 98,847,338 (GRCm39) H1658L probably damaging Het
Dync2h1 T A 9: 7,122,772 (GRCm39) E2061D probably damaging Het
Dync2h1 T C 9: 7,162,925 (GRCm39) I555V probably benign Het
Eif2ak2 T C 17: 79,171,392 (GRCm39) E337G possibly damaging Het
Fabp12 T A 3: 10,315,209 (GRCm39) D46V probably benign Het
Fcgbpl1 T C 7: 27,855,019 (GRCm39) S1882P probably benign Het
Fech C T 18: 64,611,798 (GRCm39) E79K probably damaging Het
Flnc A T 6: 29,444,362 (GRCm39) I693F probably damaging Het
Foxp2 G A 6: 15,324,643 (GRCm39) C97Y possibly damaging Het
Grin2b A G 6: 135,710,894 (GRCm39) M884T probably benign Het
Gtf2ird1 T C 5: 134,445,947 (GRCm39) D28G probably damaging Het
Gtf3c4 C A 2: 28,723,906 (GRCm39) G468W possibly damaging Het
Ift172 A T 5: 31,424,585 (GRCm39) L201* probably null Het
Ift70a1 A G 2: 75,811,279 (GRCm39) V268A probably benign Het
Il1rl2 C A 1: 40,404,374 (GRCm39) S498R probably damaging Het
Ildr1 C T 16: 36,545,903 (GRCm39) R489W probably damaging Het
Itga10 G A 3: 96,559,806 (GRCm39) G487D probably damaging Het
Klk1b8 A G 7: 43,448,640 (GRCm39) N128D probably benign Het
Lgr6 G A 1: 135,003,013 (GRCm39) T79M probably damaging Het
Med6 T C 12: 81,620,651 (GRCm39) T232A probably benign Het
Mgat4e A G 1: 134,469,060 (GRCm39) L328P probably damaging Het
Mttp A G 3: 137,824,163 (GRCm39) Y138H probably damaging Het
Ngef T C 1: 87,473,690 (GRCm39) R31G probably benign Het
Nipsnap2 C A 5: 129,830,287 (GRCm39) probably null Het
Nlgn2 G T 11: 69,719,267 (GRCm39) N194K probably damaging Het
Or1q1 G A 2: 36,887,664 (GRCm39) V281M possibly damaging Het
Or4a72 A T 2: 89,405,305 (GRCm39) M255K possibly damaging Het
Or5b98 G A 19: 12,931,696 (GRCm39) V248I possibly damaging Het
Or5m13b A G 2: 85,754,087 (GRCm39) I158M probably benign Het
Or8c16 A G 9: 38,130,728 (GRCm39) Y203C possibly damaging Het
Pcca T A 14: 123,050,634 (GRCm39) M101K possibly damaging Het
Plekha6 A G 1: 133,212,708 (GRCm39) T671A possibly damaging Het
Prex2 G A 1: 11,232,536 (GRCm39) V868M probably damaging Het
Prkcq G A 2: 11,284,332 (GRCm39) V501I probably benign Het
Prom1 T A 5: 44,168,595 (GRCm39) probably benign Het
Ptprd A G 4: 76,051,398 (GRCm39) V41A probably damaging Het
Rab39 C T 9: 53,597,698 (GRCm39) G189E possibly damaging Het
Ret T C 6: 118,157,343 (GRCm39) K236E possibly damaging Het
Rfx6 G A 10: 51,596,153 (GRCm39) probably null Het
Rnf213 A G 11: 119,352,744 (GRCm39) T3916A probably damaging Het
Rpn1 A G 6: 88,072,665 (GRCm39) N336S probably damaging Het
Sag G A 1: 87,733,037 (GRCm39) A2T probably damaging Het
Sco2 T C 15: 89,256,063 (GRCm39) Y197C probably damaging Het
Sec23b T C 2: 144,408,864 (GRCm39) I183T possibly damaging Het
Sec24b C T 3: 129,781,377 (GRCm39) V1166M probably damaging Het
Slc27a5 A T 7: 12,727,339 (GRCm39) F361Y probably damaging Het
Spaca9 A G 2: 28,586,013 (GRCm39) L17P probably damaging Het
Sqor T C 2: 122,646,027 (GRCm39) probably null Het
Stx18 A G 5: 38,292,588 (GRCm39) H230R probably damaging Het
Tas2r130 A T 6: 131,607,732 (GRCm39) I21N probably damaging Het
Tcaf3 A G 6: 42,570,658 (GRCm39) S365P possibly damaging Het
Tinagl1 G A 4: 130,060,765 (GRCm39) H351Y probably damaging Het
Tmc2 T C 2: 130,074,305 (GRCm39) Y333H probably damaging Het
Trp53bp2 A T 1: 182,270,384 (GRCm39) T395S probably damaging Het
Tsc22d1 T C 14: 76,655,773 (GRCm39) S751P probably damaging Het
Ttn A G 2: 76,657,368 (GRCm39) probably benign Het
Ugdh T C 5: 65,574,268 (GRCm39) Y425C probably damaging Het
Vmn1r115 G A 7: 20,578,094 (GRCm39) L273F probably null Het
Vmn2r109 A T 17: 20,761,448 (GRCm39) C636* probably null Het
Vmn2r59 A C 7: 41,693,203 (GRCm39) Y466D probably damaging Het
Zic5 C T 14: 122,702,242 (GRCm39) G163D unknown Het
Other mutations in Col20a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Col20a1 APN 2 180,645,272 (GRCm39) missense possibly damaging 0.93
IGL00975:Col20a1 APN 2 180,634,271 (GRCm39) missense probably damaging 1.00
IGL01094:Col20a1 APN 2 180,641,559 (GRCm39) missense probably damaging 0.99
IGL01388:Col20a1 APN 2 180,645,264 (GRCm39) missense probably benign 0.24
IGL01472:Col20a1 APN 2 180,649,625 (GRCm39) missense probably benign 0.44
IGL01936:Col20a1 APN 2 180,651,161 (GRCm39) splice site probably benign
IGL02133:Col20a1 APN 2 180,648,937 (GRCm39) missense probably damaging 1.00
IGL02318:Col20a1 APN 2 180,648,952 (GRCm39) missense probably damaging 0.99
IGL02576:Col20a1 APN 2 180,655,198 (GRCm39) nonsense probably null
IGL02822:Col20a1 APN 2 180,638,600 (GRCm39) missense probably damaging 1.00
IGL02898:Col20a1 APN 2 180,630,905 (GRCm39) nonsense probably null
IGL03056:Col20a1 APN 2 180,636,682 (GRCm39) missense probably damaging 1.00
IGL03189:Col20a1 APN 2 180,651,200 (GRCm39) nonsense probably null
IGL03196:Col20a1 APN 2 180,649,671 (GRCm39) splice site probably null
R0001:Col20a1 UTSW 2 180,626,205 (GRCm39) unclassified probably benign
R0200:Col20a1 UTSW 2 180,642,231 (GRCm39) missense probably damaging 1.00
R0384:Col20a1 UTSW 2 180,640,955 (GRCm39) missense probably benign 0.00
R0964:Col20a1 UTSW 2 180,626,278 (GRCm39) unclassified probably benign
R0975:Col20a1 UTSW 2 180,648,619 (GRCm39) missense possibly damaging 0.75
R1359:Col20a1 UTSW 2 180,641,585 (GRCm39) missense probably benign 0.02
R1395:Col20a1 UTSW 2 180,640,400 (GRCm39) missense probably damaging 0.99
R1470:Col20a1 UTSW 2 180,636,753 (GRCm39) missense probably benign 0.01
R1470:Col20a1 UTSW 2 180,636,753 (GRCm39) missense probably benign 0.01
R1508:Col20a1 UTSW 2 180,634,370 (GRCm39) missense probably damaging 0.98
R1865:Col20a1 UTSW 2 180,657,606 (GRCm39) missense possibly damaging 0.87
R1883:Col20a1 UTSW 2 180,634,703 (GRCm39) missense possibly damaging 0.52
R1884:Col20a1 UTSW 2 180,634,703 (GRCm39) missense possibly damaging 0.52
R1906:Col20a1 UTSW 2 180,640,490 (GRCm39) missense probably benign 0.00
R2121:Col20a1 UTSW 2 180,638,249 (GRCm39) missense probably damaging 0.99
R2131:Col20a1 UTSW 2 180,634,366 (GRCm39) missense probably damaging 1.00
R2343:Col20a1 UTSW 2 180,643,124 (GRCm39) missense possibly damaging 0.73
R3153:Col20a1 UTSW 2 180,650,386 (GRCm39) missense probably damaging 1.00
R3430:Col20a1 UTSW 2 180,655,078 (GRCm39) nonsense probably null
R3547:Col20a1 UTSW 2 180,636,704 (GRCm39) missense probably damaging 1.00
R3844:Col20a1 UTSW 2 180,634,242 (GRCm39) missense probably damaging 1.00
R3914:Col20a1 UTSW 2 180,640,285 (GRCm39) missense probably benign 0.00
R4414:Col20a1 UTSW 2 180,643,043 (GRCm39) missense possibly damaging 0.92
R4711:Col20a1 UTSW 2 180,634,284 (GRCm39) missense probably damaging 1.00
R4760:Col20a1 UTSW 2 180,626,196 (GRCm39) unclassified probably benign
R4771:Col20a1 UTSW 2 180,630,917 (GRCm39) missense probably benign 0.17
R4809:Col20a1 UTSW 2 180,640,454 (GRCm39) missense probably damaging 1.00
R4872:Col20a1 UTSW 2 180,639,156 (GRCm39) missense possibly damaging 0.74
R5045:Col20a1 UTSW 2 180,648,638 (GRCm39) missense probably damaging 1.00
R5238:Col20a1 UTSW 2 180,640,379 (GRCm39) missense probably damaging 1.00
R5566:Col20a1 UTSW 2 180,628,316 (GRCm39) splice site probably null
R6389:Col20a1 UTSW 2 180,634,376 (GRCm39) splice site probably null
R6422:Col20a1 UTSW 2 180,656,612 (GRCm39) missense possibly damaging 0.75
R6924:Col20a1 UTSW 2 180,638,643 (GRCm39) missense probably damaging 1.00
R6982:Col20a1 UTSW 2 180,638,499 (GRCm39) missense probably benign 0.00
R7177:Col20a1 UTSW 2 180,636,007 (GRCm39) nonsense probably null
R7195:Col20a1 UTSW 2 180,649,024 (GRCm39) missense probably damaging 1.00
R7717:Col20a1 UTSW 2 180,649,408 (GRCm39) missense probably damaging 1.00
R7872:Col20a1 UTSW 2 180,628,371 (GRCm39) missense probably benign 0.14
R8183:Col20a1 UTSW 2 180,640,207 (GRCm39) missense
R8188:Col20a1 UTSW 2 180,658,126 (GRCm39) critical splice donor site probably null
R8331:Col20a1 UTSW 2 180,638,559 (GRCm39) missense possibly damaging 0.95
R8423:Col20a1 UTSW 2 180,640,498 (GRCm39) missense probably damaging 1.00
R8803:Col20a1 UTSW 2 180,643,131 (GRCm39) missense possibly damaging 0.75
R8849:Col20a1 UTSW 2 180,640,432 (GRCm39) missense probably damaging 1.00
R8855:Col20a1 UTSW 2 180,655,684 (GRCm39) missense
R8885:Col20a1 UTSW 2 180,640,296 (GRCm39) splice site probably benign
R9160:Col20a1 UTSW 2 180,641,538 (GRCm39) missense probably benign
R9223:Col20a1 UTSW 2 180,648,528 (GRCm39) missense probably damaging 1.00
R9697:Col20a1 UTSW 2 180,641,577 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCCTATAGATAAGGTCCTGTCAG -3'
(R):5'- AGCCAATGTCATAGGCGAAG -3'

Sequencing Primer
(F):5'- TCAGGGTAGGCGTCAGAC -3'
(R):5'- TCATAGGCGAAGGAGGGTCC -3'
Posted On 2014-08-25