Mutagenetix > Incidental Mutation

Incidental Mutation 'R2020:Itga10'

223781

Institutional Source

Beutler Lab

Gene Symbol

Itga10

Ensembl Gene

ENSMUSG00000090210

Gene Name

integrin, alpha 10

Synonyms

MMRRC Submission

040029-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.234) question?

Stock #

R2020 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

96645584-96664519 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 96652490 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 487 (G487D)

Ref Sequence

ENSEMBL: ENSMUSP00000112393 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029744] [ENSMUST00000119365] [ENSMUST00000137564]

AlphaFold

E9Q6R1

Predicted Effect

probably damaging
Transcript: ENSMUST00000029744
AA Change: G487D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000029744
Gene: ENSMUSG00000090210
AA Change: G487D

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Int_alpha	37	93	9.03e-3	SMART
VWA	165	355	9.6e-43	SMART
Int_alpha	427	481	2.01e0	SMART
Int_alpha	482	539	5.14e-7	SMART
Int_alpha	545	600	5.34e-14	SMART
Int_alpha	607	652	8.75e0	SMART
transmembrane domain	1123	1145	N/A	INTRINSIC
low complexity region	1153	1166	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000119365
AA Change: G487D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000112393
Gene: ENSMUSG00000090210
AA Change: G487D

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Int_alpha	37	93	9.03e-3	SMART
VWA	165	355	9.6e-43	SMART
Int_alpha	427	481	2.01e0	SMART
Int_alpha	482	539	5.14e-7	SMART
Int_alpha	545	600	5.34e-14	SMART
Int_alpha	607	652	8.75e0	SMART
transmembrane domain	1122	1144	N/A	INTRINSIC
low complexity region	1152	1165	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127607

Predicted Effect

probably benign
Transcript: ENSMUST00000137564

SMART Domains

Protein: ENSMUSP00000121011
Gene: ENSMUSG00000106447

Domain	Start	End	E-Value	Type
Pfam:PEX11	1	172	4.5e-57	PFAM
low complexity region	186	204	N/A	INTRINSIC
Int_alpha	222	278	9.03e-3	SMART
Blast:VWA	292	345	3e-7	BLAST

Meta Mutation Damage Score

0.7915

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 93.6%

Validation Efficiency

99% (87/88)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Integrins are integral transmembrane glycoproteins composed of noncovalently linked alpha and beta chains. They participate in cell adhesion as well as cell-surface mediated signalling. This gene encodes an integrin alpha chain and is expressed at high levels in chondrocytes, where it is transcriptionally regulated by AP-2epsilon and Ets-1. The protein encoded by this gene binds to collagen. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous null mice display slightly shortened long bones and amild abnormalities in ephysiseal plate morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600012P17Rik	C	A	1: 158,968,912		noncoding transcript	Het
9530053A07Rik	T	C	7: 28,155,594	S1882P	probably benign	Het
Adam17	G	A	12: 21,349,875	R177C	probably damaging	Het
Ak7	G	A	12: 105,745,332		probably null	Het
Akap9	T	C	5: 3,961,967	V890A	probably damaging	Het
Alg6	A	G	4: 99,738,132	N59S	probably damaging	Het
Alkbh5	G	T	11: 60,538,549	A43S	probably benign	Het
Anxa2	C	A	9: 69,483,817	D162E	probably damaging	Het
Arap1	A	G	7: 101,401,518	H1136R	probably benign	Het
Arhgap18	A	G	10: 26,854,904	R121G	probably benign	Het
Arhgef4	A	T	1: 34,723,810	T716S	unknown	Het
Atg2a	T	C	19: 6,250,269		probably null	Het
Ccdc27	T	C	4: 154,033,313	I480V	probably null	Het
Cdipt	T	C	7: 126,976,933	V20A	possibly damaging	Het
Cgrrf1	C	T	14: 46,830,445		probably benign	Het
Chd7	G	A	4: 8,855,226	V2152I	probably benign	Het
Chd8	T	A	14: 52,215,241	S1274C	probably damaging	Het
Chuk	A	T	19: 44,107,343	M17K	possibly damaging	Het
Col14a1	C	T	15: 55,446,181		probably benign	Het
Col20a1	G	A	2: 181,013,163		probably null	Het
Cped1	A	G	6: 22,143,964	I570V	probably benign	Het
Cul9	C	G	17: 46,522,175	A1326P	probably damaging	Het
Ddx27	A	C	2: 167,033,771	Q674P	probably damaging	Het
Dennd6a	T	A	14: 26,612,003	F131L	probably damaging	Het
Dhx38	G	A	8: 109,556,869		probably benign	Het
Dido1	G	T	2: 180,659,585	N2175K	unknown	Het
Dmxl1	T	A	18: 49,889,558	Y1654*	probably null	Het
Dock7	T	A	4: 98,959,101	H1658L	probably damaging	Het
Dync2h1	T	A	9: 7,122,772	E2061D	probably damaging	Het
Dync2h1	T	C	9: 7,162,925	I555V	probably benign	Het
Eif2ak2	T	C	17: 78,863,963	E337G	possibly damaging	Het
Fabp12	T	A	3: 10,250,149	D46V	probably benign	Het
Fech	C	T	18: 64,478,727	E79K	probably damaging	Het
Flnc	A	T	6: 29,444,363	I693F	probably damaging	Het
Foxp2	G	A	6: 15,324,644	C97Y	possibly damaging	Het
Grin2b	A	G	6: 135,733,896	M884T	probably benign	Het
Gtf2ird1	T	C	5: 134,417,093	D28G	probably damaging	Het
Gtf3c4	C	A	2: 28,833,894	G468W	possibly damaging	Het
Ift172	A	T	5: 31,267,241	L201*	probably null	Het
Il1rl2	C	A	1: 40,365,214	S498R	probably damaging	Het
Ildr1	C	T	16: 36,725,541	R489W	probably damaging	Het
Klk8	A	G	7: 43,799,216	N128D	probably benign	Het
Lgr6	G	A	1: 135,075,275	T79M	probably damaging	Het
Med6	T	C	12: 81,573,877	T232A	probably benign	Het
Mgat4e	A	G	1: 134,541,322	L328P	probably damaging	Het
Mttp	A	G	3: 138,118,402	Y138H	probably damaging	Het
Ngef	T	C	1: 87,545,968	R31G	probably benign	Het
Nipsnap2	C	A	5: 129,753,223		probably null	Het
Nlgn2	G	T	11: 69,828,441	N194K	probably damaging	Het
Olfr1026	A	G	2: 85,923,743	I158M	probably benign	Het
Olfr1245	A	T	2: 89,574,961	M255K	possibly damaging	Het
Olfr1450	G	A	19: 12,954,332	V248I	possibly damaging	Het
Olfr357	G	A	2: 36,997,652	V281M	possibly damaging	Het
Olfr894	A	G	9: 38,219,432	Y203C	possibly damaging	Het
Pcca	T	A	14: 122,813,222	M101K	possibly damaging	Het
Plekha6	A	G	1: 133,284,970	T671A	possibly damaging	Het
Prex2	G	A	1: 11,162,312	V868M	probably damaging	Het
Prkcq	G	A	2: 11,279,521	V501I	probably benign	Het
Prom1	T	A	5: 44,011,253		probably benign	Het
Ptprd	A	G	4: 76,133,161	V41A	probably damaging	Het
Rab39	C	T	9: 53,686,398	G189E	possibly damaging	Het
Ret	T	C	6: 118,180,382	K236E	possibly damaging	Het
Rfx6	G	A	10: 51,720,057		probably null	Het
Rnf213	A	G	11: 119,461,918	T3916A	probably damaging	Het
Rpn1	A	G	6: 88,095,683	N336S	probably damaging	Het
Sag	G	A	1: 87,805,315	A2T	probably damaging	Het
Sco2	T	C	15: 89,371,860	Y197C	probably damaging	Het
Sec23b	T	C	2: 144,566,944	I183T	possibly damaging	Het
Sec24b	C	T	3: 129,987,728	V1166M	probably damaging	Het
Slc27a5	A	T	7: 12,993,412	F361Y	probably damaging	Het
Spaca9	A	G	2: 28,696,001	L17P	probably damaging	Het
Sqor	T	C	2: 122,804,107		probably null	Het
Stx18	A	G	5: 38,135,244	H230R	probably damaging	Het
Tas2r130	A	T	6: 131,630,769	I21N	probably damaging	Het
Tcaf3	A	G	6: 42,593,724	S365P	possibly damaging	Het
Tinagl1	G	A	4: 130,166,972	H351Y	probably damaging	Het
Tmc2	T	C	2: 130,232,385	Y333H	probably damaging	Het
Trp53bp2	A	T	1: 182,442,819	T395S	probably damaging	Het
Tsc22d1	T	C	14: 76,418,333	S751P	probably damaging	Het
Ttc30a1	A	G	2: 75,980,935	V268A	probably benign	Het
Ttn	A	G	2: 76,827,024		probably benign	Het
Ugdh	T	C	5: 65,416,925	Y425C	probably damaging	Het
Vmn1r115	G	A	7: 20,844,169	L273F	probably null	Het
Vmn2r109	A	T	17: 20,541,186	C636*	probably null	Het
Vmn2r59	A	C	7: 42,043,779	Y466D	probably damaging	Het
Zic5	C	T	14: 122,464,830	G163D	unknown	Het

Other mutations in Itga10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01473:Itga10	APN	3	96647641	missense	probably damaging	0.96
IGL01694:Itga10	APN	3	96652517	missense	probably damaging	0.99
IGL01754:Itga10	APN	3	96656775	unclassified	probably benign
IGL02527:Itga10	APN	3	96655624	unclassified	probably benign
IGL02956:Itga10	APN	3	96655113	missense	possibly damaging	0.46
IGL03371:Itga10	APN	3	96654788	missense	possibly damaging	0.84
IGL03055:Itga10	UTSW	3	96650520	missense	probably damaging	0.99
PIT4515001:Itga10	UTSW	3	96662632	missense	probably damaging	0.99
R0153:Itga10	UTSW	3	96653700	missense	probably benign	0.00
R0308:Itga10	UTSW	3	96651464	missense	probably damaging	1.00
R0331:Itga10	UTSW	3	96652483	missense	probably damaging	1.00
R0413:Itga10	UTSW	3	96649059	missense	probably damaging	1.00
R0437:Itga10	UTSW	3	96649137	missense	probably damaging	1.00
R0511:Itga10	UTSW	3	96658174	missense	probably damaging	1.00
R0630:Itga10	UTSW	3	96656299	unclassified	probably benign
R0844:Itga10	UTSW	3	96651738	splice site	probably benign
R0849:Itga10	UTSW	3	96652530	missense	possibly damaging	0.67
R0894:Itga10	UTSW	3	96653660	missense	possibly damaging	0.69
R0919:Itga10	UTSW	3	96651738	splice site	probably benign
R1027:Itga10	UTSW	3	96651738	splice site	probably benign
R1341:Itga10	UTSW	3	96652495	missense	probably damaging	1.00
R1350:Itga10	UTSW	3	96657477	missense	probably benign	0.01
R1370:Itga10	UTSW	3	96651738	splice site	probably benign
R1467:Itga10	UTSW	3	96652229	nonsense	probably null
R1467:Itga10	UTSW	3	96652229	nonsense	probably null
R1589:Itga10	UTSW	3	96651738	splice site	probably benign
R1590:Itga10	UTSW	3	96651738	splice site	probably benign
R1601:Itga10	UTSW	3	96653658	missense	possibly damaging	0.82
R1659:Itga10	UTSW	3	96662977	missense	probably damaging	0.96
R1665:Itga10	UTSW	3	96651738	splice site	probably benign
R1667:Itga10	UTSW	3	96651738	splice site	probably benign
R1686:Itga10	UTSW	3	96651825	missense	probably damaging	0.97
R1972:Itga10	UTSW	3	96651738	splice site	probably benign
R1976:Itga10	UTSW	3	96651738	splice site	probably benign
R2040:Itga10	UTSW	3	96651738	splice site	probably benign
R2044:Itga10	UTSW	3	96651738	splice site	probably benign
R2044:Itga10	UTSW	3	96657690	missense	probably benign
R2045:Itga10	UTSW	3	96651738	splice site	probably benign
R2060:Itga10	UTSW	3	96654998	nonsense	probably null
R2146:Itga10	UTSW	3	96651492	missense	possibly damaging	0.59
R2146:Itga10	UTSW	3	96653723	missense	probably damaging	1.00
R2170:Itga10	UTSW	3	96650457	missense	probably damaging	1.00
R2893:Itga10	UTSW	3	96655100	missense	probably benign	0.11
R2926:Itga10	UTSW	3	96652849	missense	probably damaging	1.00
R3622:Itga10	UTSW	3	96651738	splice site	probably benign
R3623:Itga10	UTSW	3	96651738	splice site	probably benign
R4416:Itga10	UTSW	3	96658246	missense	possibly damaging	0.58
R4633:Itga10	UTSW	3	96647704	missense	possibly damaging	0.92
R5074:Itga10	UTSW	3	96652211	nonsense	probably null
R5095:Itga10	UTSW	3	96648164	missense	probably benign	0.21
R5495:Itga10	UTSW	3	96647371	missense	possibly damaging	0.92
R5813:Itga10	UTSW	3	96652585	missense	probably benign	0.38
R6114:Itga10	UTSW	3	96649035	missense	probably damaging	1.00
R6172:Itga10	UTSW	3	96647437	missense	probably benign	0.18
R6275:Itga10	UTSW	3	96658185	missense	probably benign	0.36
R6298:Itga10	UTSW	3	96656762	missense	probably benign	0.00
R6433:Itga10	UTSW	3	96658041	critical splice donor site	probably null
R6841:Itga10	UTSW	3	96656714	missense	probably damaging	1.00
R6909:Itga10	UTSW	3	96662599	missense	probably benign	0.00
R6927:Itga10	UTSW	3	96656714	missense	probably damaging	1.00
R7124:Itga10	UTSW	3	96651765	missense	probably damaging	0.96
R7310:Itga10	UTSW	3	96648159	missense	probably damaging	1.00
R7387:Itga10	UTSW	3	96652778	missense	probably benign	0.11
R7464:Itga10	UTSW	3	96648155	missense	probably damaging	1.00
R7624:Itga10	UTSW	3	96652953	missense	probably benign
R7638:Itga10	UTSW	3	96657391	splice site	probably null
R7639:Itga10	UTSW	3	96649582	missense	probably benign	0.36
R7893:Itga10	UTSW	3	96649612	missense	probably damaging	1.00
R8297:Itga10	UTSW	3	96654800	missense	probably damaging	1.00
R8753:Itga10	UTSW	3	96651155	missense	probably damaging	1.00
R9526:Itga10	UTSW	3	96656957	missense	probably damaging	1.00
X0064:Itga10	UTSW	3	96652936	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- CATCAACAGAGGGTGGGACC -3'
(R):5'- TGGTGACCTTTGCCCCTTAG -3'

Sequencing Primer
(F):5'- GACCCTTGGACCGCTTC -3'
(R):5'- GCAAGCTCTCAAATATGTGTGCC -3'

Posted On

2014-08-25