Incidental Mutation 'R2020:Dock7'
ID 223792
Institutional Source Beutler Lab
Gene Symbol Dock7
Ensembl Gene ENSMUSG00000028556
Gene Name dedicator of cytokinesis 7
Synonyms m, LOC242555, 3110056M06Rik
MMRRC Submission 040029-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2020 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 98824908-99009152 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 98847338 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 1658 (H1658L)
Ref Sequence ENSEMBL: ENSMUSP00000145604 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030286] [ENSMUST00000075836] [ENSMUST00000127417] [ENSMUST00000205650] [ENSMUST00000205652]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000030286
AA Change: H1688L

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000030286
Gene: ENSMUSG00000028556
AA Change: H1688L

DomainStartEndE-ValueType
Pfam:DUF3398 67 159 6.5e-30 PFAM
coiled coil region 367 394 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
Pfam:DOCK-C2 557 736 1.8e-51 PFAM
low complexity region 789 799 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 888 901 N/A INTRINSIC
low complexity region 1135 1163 N/A INTRINSIC
low complexity region 1350 1364 N/A INTRINSIC
low complexity region 1543 1565 N/A INTRINSIC
Pfam:DHR-2 1571 2095 1.4e-217 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000075836
AA Change: H1658L
SMART Domains Protein: ENSMUSP00000075233
Gene: ENSMUSG00000028556
AA Change: H1658L

DomainStartEndE-ValueType
Pfam:DUF3398 65 159 5.8e-34 PFAM
coiled coil region 367 394 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
Pfam:DOCK-C2 556 737 3.3e-58 PFAM
low complexity region 789 799 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 888 901 N/A INTRINSIC
low complexity region 1105 1133 N/A INTRINSIC
low complexity region 1320 1334 N/A INTRINSIC
low complexity region 1513 1535 N/A INTRINSIC
Pfam:Ded_cyto 1888 2065 6.5e-80 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124040
Predicted Effect probably benign
Transcript: ENSMUST00000124466
Predicted Effect unknown
Transcript: ENSMUST00000127417
AA Change: H1688L
SMART Domains Protein: ENSMUSP00000117797
Gene: ENSMUSG00000028556
AA Change: H1688L

DomainStartEndE-ValueType
low complexity region 140 162 N/A INTRINSIC
Pfam:Ded_cyto 517 694 3e-80 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139152
Predicted Effect probably damaging
Transcript: ENSMUST00000205650
AA Change: H1658L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140848
Predicted Effect probably benign
Transcript: ENSMUST00000205652
Meta Mutation Damage Score 0.8811 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.6%
Validation Efficiency 99% (87/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a guanine nucleotide exchange factor (GEF) that plays a role in axon formation and neuronal polarization. The encoded protein displays GEF activity toward RAC1 and RAC3 Rho small GTPases but not toward CDC42. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for mutations of this gene exhibit coat color dilution, white tail tip, and on some genetic backgrounds a white belly spot. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012P17Rik C A 1: 158,796,482 (GRCm39) noncoding transcript Het
Adam17 G A 12: 21,399,876 (GRCm39) R177C probably damaging Het
Ak7 G A 12: 105,711,591 (GRCm39) probably null Het
Akap9 T C 5: 4,011,967 (GRCm39) V890A probably damaging Het
Alg6 A G 4: 99,626,369 (GRCm39) N59S probably damaging Het
Alkbh5 G T 11: 60,429,375 (GRCm39) A43S probably benign Het
Anxa2 C A 9: 69,391,099 (GRCm39) D162E probably damaging Het
Arap1 A G 7: 101,050,725 (GRCm39) H1136R probably benign Het
Arhgap18 A G 10: 26,730,900 (GRCm39) R121G probably benign Het
Arhgef4 A T 1: 34,762,891 (GRCm39) T716S unknown Het
Atg2a T C 19: 6,300,299 (GRCm39) probably null Het
Ccdc27 T C 4: 154,117,770 (GRCm39) I480V probably null Het
Cdipt T C 7: 126,576,105 (GRCm39) V20A possibly damaging Het
Cgrrf1 C T 14: 47,067,902 (GRCm39) probably benign Het
Chd7 G A 4: 8,855,226 (GRCm39) V2152I probably benign Het
Chd8 T A 14: 52,452,698 (GRCm39) S1274C probably damaging Het
Chuk A T 19: 44,095,782 (GRCm39) M17K possibly damaging Het
Col14a1 C T 15: 55,309,577 (GRCm39) probably benign Het
Col20a1 G A 2: 180,654,956 (GRCm39) probably null Het
Cped1 A G 6: 22,143,963 (GRCm39) I570V probably benign Het
Cul9 C G 17: 46,833,101 (GRCm39) A1326P probably damaging Het
Ddx27 A C 2: 166,875,691 (GRCm39) Q674P probably damaging Het
Dennd6a T A 14: 26,333,158 (GRCm39) F131L probably damaging Het
Dhx38 G A 8: 110,283,501 (GRCm39) probably benign Het
Dido1 G T 2: 180,301,378 (GRCm39) N2175K unknown Het
Dmxl1 T A 18: 50,022,625 (GRCm39) Y1654* probably null Het
Dync2h1 T A 9: 7,122,772 (GRCm39) E2061D probably damaging Het
Dync2h1 T C 9: 7,162,925 (GRCm39) I555V probably benign Het
Eif2ak2 T C 17: 79,171,392 (GRCm39) E337G possibly damaging Het
Fabp12 T A 3: 10,315,209 (GRCm39) D46V probably benign Het
Fcgbpl1 T C 7: 27,855,019 (GRCm39) S1882P probably benign Het
Fech C T 18: 64,611,798 (GRCm39) E79K probably damaging Het
Flnc A T 6: 29,444,362 (GRCm39) I693F probably damaging Het
Foxp2 G A 6: 15,324,643 (GRCm39) C97Y possibly damaging Het
Grin2b A G 6: 135,710,894 (GRCm39) M884T probably benign Het
Gtf2ird1 T C 5: 134,445,947 (GRCm39) D28G probably damaging Het
Gtf3c4 C A 2: 28,723,906 (GRCm39) G468W possibly damaging Het
Ift172 A T 5: 31,424,585 (GRCm39) L201* probably null Het
Ift70a1 A G 2: 75,811,279 (GRCm39) V268A probably benign Het
Il1rl2 C A 1: 40,404,374 (GRCm39) S498R probably damaging Het
Ildr1 C T 16: 36,545,903 (GRCm39) R489W probably damaging Het
Itga10 G A 3: 96,559,806 (GRCm39) G487D probably damaging Het
Klk1b8 A G 7: 43,448,640 (GRCm39) N128D probably benign Het
Lgr6 G A 1: 135,003,013 (GRCm39) T79M probably damaging Het
Med6 T C 12: 81,620,651 (GRCm39) T232A probably benign Het
Mgat4e A G 1: 134,469,060 (GRCm39) L328P probably damaging Het
Mttp A G 3: 137,824,163 (GRCm39) Y138H probably damaging Het
Ngef T C 1: 87,473,690 (GRCm39) R31G probably benign Het
Nipsnap2 C A 5: 129,830,287 (GRCm39) probably null Het
Nlgn2 G T 11: 69,719,267 (GRCm39) N194K probably damaging Het
Or1q1 G A 2: 36,887,664 (GRCm39) V281M possibly damaging Het
Or4a72 A T 2: 89,405,305 (GRCm39) M255K possibly damaging Het
Or5b98 G A 19: 12,931,696 (GRCm39) V248I possibly damaging Het
Or5m13b A G 2: 85,754,087 (GRCm39) I158M probably benign Het
Or8c16 A G 9: 38,130,728 (GRCm39) Y203C possibly damaging Het
Pcca T A 14: 123,050,634 (GRCm39) M101K possibly damaging Het
Plekha6 A G 1: 133,212,708 (GRCm39) T671A possibly damaging Het
Prex2 G A 1: 11,232,536 (GRCm39) V868M probably damaging Het
Prkcq G A 2: 11,284,332 (GRCm39) V501I probably benign Het
Prom1 T A 5: 44,168,595 (GRCm39) probably benign Het
Ptprd A G 4: 76,051,398 (GRCm39) V41A probably damaging Het
Rab39 C T 9: 53,597,698 (GRCm39) G189E possibly damaging Het
Ret T C 6: 118,157,343 (GRCm39) K236E possibly damaging Het
Rfx6 G A 10: 51,596,153 (GRCm39) probably null Het
Rnf213 A G 11: 119,352,744 (GRCm39) T3916A probably damaging Het
Rpn1 A G 6: 88,072,665 (GRCm39) N336S probably damaging Het
Sag G A 1: 87,733,037 (GRCm39) A2T probably damaging Het
Sco2 T C 15: 89,256,063 (GRCm39) Y197C probably damaging Het
Sec23b T C 2: 144,408,864 (GRCm39) I183T possibly damaging Het
Sec24b C T 3: 129,781,377 (GRCm39) V1166M probably damaging Het
Slc27a5 A T 7: 12,727,339 (GRCm39) F361Y probably damaging Het
Spaca9 A G 2: 28,586,013 (GRCm39) L17P probably damaging Het
Sqor T C 2: 122,646,027 (GRCm39) probably null Het
Stx18 A G 5: 38,292,588 (GRCm39) H230R probably damaging Het
Tas2r130 A T 6: 131,607,732 (GRCm39) I21N probably damaging Het
Tcaf3 A G 6: 42,570,658 (GRCm39) S365P possibly damaging Het
Tinagl1 G A 4: 130,060,765 (GRCm39) H351Y probably damaging Het
Tmc2 T C 2: 130,074,305 (GRCm39) Y333H probably damaging Het
Trp53bp2 A T 1: 182,270,384 (GRCm39) T395S probably damaging Het
Tsc22d1 T C 14: 76,655,773 (GRCm39) S751P probably damaging Het
Ttn A G 2: 76,657,368 (GRCm39) probably benign Het
Ugdh T C 5: 65,574,268 (GRCm39) Y425C probably damaging Het
Vmn1r115 G A 7: 20,578,094 (GRCm39) L273F probably null Het
Vmn2r109 A T 17: 20,761,448 (GRCm39) C636* probably null Het
Vmn2r59 A C 7: 41,693,203 (GRCm39) Y466D probably damaging Het
Zic5 C T 14: 122,702,242 (GRCm39) G163D unknown Het
Other mutations in Dock7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Dock7 APN 4 98,952,222 (GRCm39) missense probably damaging 1.00
IGL01126:Dock7 APN 4 98,861,789 (GRCm39) splice site probably benign
IGL01490:Dock7 APN 4 98,833,355 (GRCm39) unclassified probably benign
IGL01553:Dock7 APN 4 98,833,803 (GRCm39) nonsense probably null
IGL01728:Dock7 APN 4 98,850,568 (GRCm39) missense probably damaging 1.00
IGL01776:Dock7 APN 4 98,829,178 (GRCm39) missense possibly damaging 0.65
IGL01954:Dock7 APN 4 98,971,388 (GRCm39) missense probably damaging 0.99
IGL01985:Dock7 APN 4 98,911,614 (GRCm39) missense probably benign 0.35
IGL02054:Dock7 APN 4 98,861,646 (GRCm39) missense probably damaging 1.00
IGL02150:Dock7 APN 4 98,968,089 (GRCm39) splice site probably benign
IGL02153:Dock7 APN 4 98,846,304 (GRCm39) missense probably benign 0.15
IGL02183:Dock7 APN 4 98,847,228 (GRCm39) missense possibly damaging 0.89
IGL02494:Dock7 APN 4 98,877,471 (GRCm39) missense probably benign 0.18
IGL02618:Dock7 APN 4 98,971,265 (GRCm39) missense probably benign 0.00
IGL02634:Dock7 APN 4 98,877,533 (GRCm39) missense probably damaging 1.00
IGL02670:Dock7 APN 4 98,854,523 (GRCm39) splice site probably null
IGL02690:Dock7 APN 4 98,857,872 (GRCm39) missense possibly damaging 0.95
IGL02692:Dock7 APN 4 98,875,623 (GRCm39) missense probably damaging 1.00
IGL02833:Dock7 APN 4 98,833,732 (GRCm39) missense probably damaging 1.00
IGL02858:Dock7 APN 4 98,833,442 (GRCm39) nonsense probably null
IGL02875:Dock7 APN 4 98,864,231 (GRCm39) missense probably benign 0.00
IGL03027:Dock7 APN 4 98,958,450 (GRCm39) missense possibly damaging 0.71
IGL03027:Dock7 APN 4 98,866,164 (GRCm39) missense probably benign
IGL03032:Dock7 APN 4 98,854,585 (GRCm39) missense probably benign 0.02
IGL03104:Dock7 APN 4 98,847,260 (GRCm39) missense possibly damaging 0.60
IGL03136:Dock7 APN 4 98,892,028 (GRCm39) missense probably damaging 1.00
IGL03345:Dock7 APN 4 98,873,056 (GRCm39) missense possibly damaging 0.91
Beaming UTSW 4 98,967,992 (GRCm39) nonsense probably null
moonlight UTSW 4 0 () large deletion
Nocturn UTSW 4 98,952,199 (GRCm39) missense probably benign 0.00
sonata UTSW 4 98,889,364 (GRCm39) nonsense probably null
BB005:Dock7 UTSW 4 98,889,335 (GRCm39) missense
BB015:Dock7 UTSW 4 98,889,335 (GRCm39) missense
PIT4810001:Dock7 UTSW 4 98,833,796 (GRCm39) nonsense probably null
R0086:Dock7 UTSW 4 98,833,381 (GRCm39) missense probably damaging 1.00
R0242:Dock7 UTSW 4 98,850,517 (GRCm39) missense probably benign
R0242:Dock7 UTSW 4 98,850,517 (GRCm39) missense probably benign
R0245:Dock7 UTSW 4 98,943,586 (GRCm39) missense possibly damaging 0.64
R0308:Dock7 UTSW 4 98,873,051 (GRCm39) missense probably benign 0.07
R0556:Dock7 UTSW 4 98,833,426 (GRCm39) missense probably damaging 1.00
R0612:Dock7 UTSW 4 98,877,470 (GRCm39) missense probably benign 0.31
R0652:Dock7 UTSW 4 98,943,586 (GRCm39) missense possibly damaging 0.64
R0669:Dock7 UTSW 4 98,875,716 (GRCm39) missense probably benign 0.00
R0681:Dock7 UTSW 4 98,904,941 (GRCm39) missense probably damaging 1.00
R0725:Dock7 UTSW 4 98,833,528 (GRCm39) missense probably damaging 1.00
R0828:Dock7 UTSW 4 98,903,982 (GRCm39) missense probably damaging 1.00
R0837:Dock7 UTSW 4 98,877,495 (GRCm39) missense probably benign 0.01
R0962:Dock7 UTSW 4 98,833,432 (GRCm39) missense possibly damaging 0.85
R1140:Dock7 UTSW 4 98,953,643 (GRCm39) missense possibly damaging 0.82
R1476:Dock7 UTSW 4 98,967,672 (GRCm39) missense possibly damaging 0.52
R1614:Dock7 UTSW 4 98,949,517 (GRCm39) missense probably benign 0.12
R1625:Dock7 UTSW 4 98,850,433 (GRCm39) splice site probably null
R1640:Dock7 UTSW 4 98,833,483 (GRCm39) missense probably damaging 1.00
R1752:Dock7 UTSW 4 98,854,681 (GRCm39) missense probably damaging 1.00
R1941:Dock7 UTSW 4 98,872,952 (GRCm39) missense probably benign 0.09
R2092:Dock7 UTSW 4 98,897,545 (GRCm39) missense possibly damaging 0.95
R2293:Dock7 UTSW 4 98,854,606 (GRCm39) missense probably damaging 1.00
R2424:Dock7 UTSW 4 98,833,544 (GRCm39) nonsense probably null
R3767:Dock7 UTSW 4 98,859,066 (GRCm39) missense probably benign
R3768:Dock7 UTSW 4 98,859,066 (GRCm39) missense probably benign
R3769:Dock7 UTSW 4 98,859,066 (GRCm39) missense probably benign
R3770:Dock7 UTSW 4 98,859,066 (GRCm39) missense probably benign
R3917:Dock7 UTSW 4 98,904,922 (GRCm39) missense probably damaging 1.00
R3943:Dock7 UTSW 4 98,880,668 (GRCm39) missense probably damaging 1.00
R4021:Dock7 UTSW 4 98,892,157 (GRCm39) splice site probably null
R4073:Dock7 UTSW 4 98,896,296 (GRCm39) missense probably benign 0.02
R4170:Dock7 UTSW 4 98,854,638 (GRCm39) missense probably damaging 0.99
R4180:Dock7 UTSW 4 98,904,973 (GRCm39) missense probably benign 0.05
R4261:Dock7 UTSW 4 98,892,123 (GRCm39) missense possibly damaging 0.78
R4321:Dock7 UTSW 4 98,960,691 (GRCm39) missense probably damaging 1.00
R4522:Dock7 UTSW 4 98,850,461 (GRCm39) missense probably damaging 1.00
R4582:Dock7 UTSW 4 98,892,153 (GRCm39) missense possibly damaging 0.90
R4648:Dock7 UTSW 4 98,857,881 (GRCm39) nonsense probably null
R4940:Dock7 UTSW 4 98,908,314 (GRCm39) missense probably damaging 1.00
R5090:Dock7 UTSW 4 98,879,648 (GRCm39) missense probably benign 0.04
R5374:Dock7 UTSW 4 98,877,275 (GRCm39) missense possibly damaging 0.81
R5392:Dock7 UTSW 4 98,896,243 (GRCm39) missense probably damaging 1.00
R5527:Dock7 UTSW 4 98,842,105 (GRCm39) intron probably benign
R5544:Dock7 UTSW 4 98,855,494 (GRCm39) missense probably damaging 1.00
R5556:Dock7 UTSW 4 98,832,972 (GRCm39) missense probably damaging 1.00
R5870:Dock7 UTSW 4 98,952,199 (GRCm39) missense probably benign 0.00
R5899:Dock7 UTSW 4 98,879,660 (GRCm39) missense probably benign
R6360:Dock7 UTSW 4 98,857,899 (GRCm39) missense probably benign 0.02
R6415:Dock7 UTSW 4 98,880,685 (GRCm39) missense probably damaging 1.00
R6468:Dock7 UTSW 4 98,855,464 (GRCm39) missense probably benign 0.15
R6562:Dock7 UTSW 4 98,879,647 (GRCm39) missense probably damaging 0.97
R6613:Dock7 UTSW 4 98,866,197 (GRCm39) missense probably damaging 0.99
R6703:Dock7 UTSW 4 98,834,909 (GRCm39) missense probably damaging 1.00
R6723:Dock7 UTSW 4 98,892,153 (GRCm39) missense possibly damaging 0.90
R6786:Dock7 UTSW 4 98,949,529 (GRCm39) missense probably benign 0.42
R7026:Dock7 UTSW 4 98,967,156 (GRCm39) missense probably benign
R7051:Dock7 UTSW 4 98,834,969 (GRCm39) missense probably damaging 1.00
R7074:Dock7 UTSW 4 98,833,445 (GRCm39) missense unknown
R7106:Dock7 UTSW 4 98,855,563 (GRCm39) missense unknown
R7147:Dock7 UTSW 4 98,849,654 (GRCm39) missense unknown
R7257:Dock7 UTSW 4 98,861,649 (GRCm39) missense unknown
R7334:Dock7 UTSW 4 98,864,180 (GRCm39) missense unknown
R7511:Dock7 UTSW 4 98,967,992 (GRCm39) nonsense probably null
R7511:Dock7 UTSW 4 98,949,519 (GRCm39) missense
R7729:Dock7 UTSW 4 98,943,683 (GRCm39) missense
R7928:Dock7 UTSW 4 98,889,335 (GRCm39) missense
R7984:Dock7 UTSW 4 98,877,303 (GRCm39) missense unknown
R8287:Dock7 UTSW 4 98,866,157 (GRCm39) missense unknown
R8439:Dock7 UTSW 4 98,971,266 (GRCm39) missense
R8466:Dock7 UTSW 4 98,952,336 (GRCm39) missense possibly damaging 0.70
R8758:Dock7 UTSW 4 98,949,555 (GRCm39) missense
R8849:Dock7 UTSW 4 98,904,986 (GRCm39) missense
R8944:Dock7 UTSW 4 98,829,243 (GRCm39) missense probably damaging 1.00
R8964:Dock7 UTSW 4 98,949,476 (GRCm39) missense
R9008:Dock7 UTSW 4 98,833,448 (GRCm39) nonsense probably null
R9040:Dock7 UTSW 4 98,889,364 (GRCm39) nonsense probably null
R9160:Dock7 UTSW 4 98,857,962 (GRCm39) missense unknown
R9168:Dock7 UTSW 4 98,953,643 (GRCm39) missense
R9189:Dock7 UTSW 4 98,877,350 (GRCm39) missense unknown
R9215:Dock7 UTSW 4 98,859,088 (GRCm39) missense unknown
R9243:Dock7 UTSW 4 98,857,871 (GRCm39) missense unknown
R9256:Dock7 UTSW 4 98,971,272 (GRCm39) missense
R9328:Dock7 UTSW 4 98,968,064 (GRCm39) missense
R9332:Dock7 UTSW 4 98,896,280 (GRCm39) missense
R9450:Dock7 UTSW 4 98,861,426 (GRCm39) missense unknown
R9584:Dock7 UTSW 4 98,861,481 (GRCm39) nonsense probably null
R9631:Dock7 UTSW 4 98,854,560 (GRCm39) missense unknown
R9676:Dock7 UTSW 4 98,904,922 (GRCm39) missense probably damaging 1.00
R9701:Dock7 UTSW 4 98,846,384 (GRCm39) missense unknown
R9723:Dock7 UTSW 4 98,960,660 (GRCm39) missense
R9723:Dock7 UTSW 4 98,908,270 (GRCm39) missense
R9727:Dock7 UTSW 4 98,875,568 (GRCm39) missense unknown
R9777:Dock7 UTSW 4 98,877,464 (GRCm39) missense unknown
R9802:Dock7 UTSW 4 98,846,384 (GRCm39) missense unknown
X0027:Dock7 UTSW 4 98,892,090 (GRCm39) missense probably damaging 0.99
Z1176:Dock7 UTSW 4 98,833,462 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- ACAGTCATTCACCTTGCCAAG -3'
(R):5'- ACAGTGACATTTTCCAGCCAC -3'

Sequencing Primer
(F):5'- GGTCTGGCCTTACTTCCTG -3'
(R):5'- TAACAGGTTGATGCCCTAGC -3'
Posted On 2014-08-25