Mutagenetix > Incidental Mutations

Incidental Mutation 'R2020:Ift172'

223804

Institutional Source

Beutler Lab

Gene Symbol

Ift172

Ensembl Gene

ENSMUSG00000038564

Gene Name

intraflagellar transport 172

Synonyms

wim

MMRRC Submission

040029-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2020 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

31253277-31291116 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 31267241 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Stop codon at position 201 (L201*)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041565]

AlphaFold

Q6VH22

Predicted Effect

probably null
Transcript: ENSMUST00000041565
AA Change: L703*

SMART Domains

Protein: ENSMUSP00000049335
Gene: ENSMUSG00000038564
AA Change: L703*

Domain	Start	End	E-Value	Type
WD40	2	44	6e-3	SMART
WD40	55	94	2.22e0	SMART
WD40	102	139	1.23e2	SMART
WD40	141	180	4.6e0	SMART
WD40	186	223	3.3e1	SMART
WD40	225	267	4.42e1	SMART
WD40	279	314	1.03e1	SMART
Blast:WD40	516	550	5e-13	BLAST
low complexity region	573	588	N/A	INTRINSIC
internal_repeat_1	625	1026	1.7e-10	PROSPERO
Blast:TPR	1029	1062	2e-13	BLAST
low complexity region	1077	1091	N/A	INTRINSIC
internal_repeat_1	1101	1498	1.7e-10	PROSPERO

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200936

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201953

Predicted Effect

probably null
Transcript: ENSMUST00000202585
AA Change: L201*

SMART Domains

Protein: ENSMUSP00000144216
Gene: ENSMUSG00000038564
AA Change: L201*

Domain	Start	End	E-Value	Type
Blast:WD40	46	78	2e-11	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000202589

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 93.6%

Validation Efficiency

99% (87/88)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the intraflagellar transport subcomplex IFT-B. Subcomplexes IFT-A and IFT-B are necessary for ciliary assembly and maintenance. Mutations in this gene have been associated with skeletal ciliopathies, with or without polydactyly, such as such short-rib thoracic dysplasias 1, 9 or 10. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene display embryonic lethality during organogenesis, neural tube defects, and developmental patterning abnormalities. Mice homozygous for a conditional allele activated in the early limb bud exhibit polydactyly and short limbs. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600012P17Rik	C	A	1: 158,968,912		noncoding transcript	Het
9530053A07Rik	T	C	7: 28,155,594	S1882P	probably benign	Het
Adam17	G	A	12: 21,349,875	R177C	probably damaging	Het
Ak7	G	A	12: 105,745,332		probably null	Het
Akap9	T	C	5: 3,961,967	V890A	probably damaging	Het
Alg6	A	G	4: 99,738,132	N59S	probably damaging	Het
Alkbh5	G	T	11: 60,538,549	A43S	probably benign	Het
Anxa2	C	A	9: 69,483,817	D162E	probably damaging	Het
Arap1	A	G	7: 101,401,518	H1136R	probably benign	Het
Arhgap18	A	G	10: 26,854,904	R121G	probably benign	Het
Arhgef4	A	T	1: 34,723,810	T716S	unknown	Het
Atg2a	T	C	19: 6,250,269		probably null	Het
Ccdc27	T	C	4: 154,033,313	I480V	probably null	Het
Cdipt	T	C	7: 126,976,933	V20A	possibly damaging	Het
Cgrrf1	C	T	14: 46,830,445		probably benign	Het
Chd7	G	A	4: 8,855,226	V2152I	probably benign	Het
Chd8	T	A	14: 52,215,241	S1274C	probably damaging	Het
Chuk	A	T	19: 44,107,343	M17K	possibly damaging	Het
Col14a1	C	T	15: 55,446,181		probably benign	Het
Col20a1	G	A	2: 181,013,163		probably null	Het
Cped1	A	G	6: 22,143,964	I570V	probably benign	Het
Cul9	C	G	17: 46,522,175	A1326P	probably damaging	Het
Ddx27	A	C	2: 167,033,771	Q674P	probably damaging	Het
Dennd6a	T	A	14: 26,612,003	F131L	probably damaging	Het
Dhx38	G	A	8: 109,556,869		probably benign	Het
Dido1	G	T	2: 180,659,585	N2175K	unknown	Het
Dmxl1	T	A	18: 49,889,558	Y1654*	probably null	Het
Dock7	T	A	4: 98,959,101	H1658L	probably damaging	Het
Dync2h1	T	A	9: 7,122,772	E2061D	probably damaging	Het
Dync2h1	T	C	9: 7,162,925	I555V	probably benign	Het
Eif2ak2	T	C	17: 78,863,963	E337G	possibly damaging	Het
Fabp12	T	A	3: 10,250,149	D46V	probably benign	Het
Fech	C	T	18: 64,478,727	E79K	probably damaging	Het
Flnc	A	T	6: 29,444,363	I693F	probably damaging	Het
Foxp2	G	A	6: 15,324,644	C97Y	possibly damaging	Het
Grin2b	A	G	6: 135,733,896	M884T	probably benign	Het
Gtf2ird1	T	C	5: 134,417,093	D28G	probably damaging	Het
Gtf3c4	C	A	2: 28,833,894	G468W	possibly damaging	Het
Il1rl2	C	A	1: 40,365,214	S498R	probably damaging	Het
Ildr1	C	T	16: 36,725,541	R489W	probably damaging	Het
Itga10	G	A	3: 96,652,490	G487D	probably damaging	Het
Klk8	A	G	7: 43,799,216	N128D	probably benign	Het
Lgr6	G	A	1: 135,075,275	T79M	probably damaging	Het
Med6	T	C	12: 81,573,877	T232A	probably benign	Het
Mgat4e	A	G	1: 134,541,322	L328P	probably damaging	Het
Mttp	A	G	3: 138,118,402	Y138H	probably damaging	Het
Ngef	T	C	1: 87,545,968	R31G	probably benign	Het
Nipsnap2	C	A	5: 129,753,223		probably null	Het
Nlgn2	G	T	11: 69,828,441	N194K	probably damaging	Het
Olfr1026	A	G	2: 85,923,743	I158M	probably benign	Het
Olfr1245	A	T	2: 89,574,961	M255K	possibly damaging	Het
Olfr1450	G	A	19: 12,954,332	V248I	possibly damaging	Het
Olfr357	G	A	2: 36,997,652	V281M	possibly damaging	Het
Olfr894	A	G	9: 38,219,432	Y203C	possibly damaging	Het
Pcca	T	A	14: 122,813,222	M101K	possibly damaging	Het
Plekha6	A	G	1: 133,284,970	T671A	possibly damaging	Het
Prex2	G	A	1: 11,162,312	V868M	probably damaging	Het
Prkcq	G	A	2: 11,279,521	V501I	probably benign	Het
Prom1	T	A	5: 44,011,253		probably benign	Het
Ptprd	A	G	4: 76,133,161	V41A	probably damaging	Het
Rab39	C	T	9: 53,686,398	G189E	possibly damaging	Het
Ret	T	C	6: 118,180,382	K236E	possibly damaging	Het
Rfx6	G	A	10: 51,720,057		probably null	Het
Rnf213	A	G	11: 119,461,918	T3916A	probably damaging	Het
Rpn1	A	G	6: 88,095,683	N336S	probably damaging	Het
Sag	G	A	1: 87,805,315	A2T	probably damaging	Het
Sco2	T	C	15: 89,371,860	Y197C	probably damaging	Het
Sec23b	T	C	2: 144,566,944	I183T	possibly damaging	Het
Sec24b	C	T	3: 129,987,728	V1166M	probably damaging	Het
Slc27a5	A	T	7: 12,993,412	F361Y	probably damaging	Het
Spaca9	A	G	2: 28,696,001	L17P	probably damaging	Het
Sqor	T	C	2: 122,804,107		probably null	Het
Stx18	A	G	5: 38,135,244	H230R	probably damaging	Het
Tas2r130	A	T	6: 131,630,769	I21N	probably damaging	Het
Tcaf3	A	G	6: 42,593,724	S365P	possibly damaging	Het
Tinagl1	G	A	4: 130,166,972	H351Y	probably damaging	Het
Tmc2	T	C	2: 130,232,385	Y333H	probably damaging	Het
Trp53bp2	A	T	1: 182,442,819	T395S	probably damaging	Het
Tsc22d1	T	C	14: 76,418,333	S751P	probably damaging	Het
Ttc30a1	A	G	2: 75,980,935	V268A	probably benign	Het
Ttn	A	G	2: 76,827,024		probably benign	Het
Ugdh	T	C	5: 65,416,925	Y425C	probably damaging	Het
Vmn1r115	G	A	7: 20,844,169	L273F	probably null	Het
Vmn2r109	A	T	17: 20,541,186	C636*	probably null	Het
Vmn2r59	A	C	7: 42,043,779	Y466D	probably damaging	Het
Zic5	C	T	14: 122,464,830	G163D	unknown	Het

Other mutations in Ift172

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00476:Ift172	APN	5	31275896	missense	probably damaging	1.00
IGL01399:Ift172	APN	5	31266248	missense	probably benign
IGL01405:Ift172	APN	5	31261852	nonsense	probably null
IGL01562:Ift172	APN	5	31267247	missense	probably damaging	0.97
IGL01758:Ift172	APN	5	31280714	missense	probably benign
IGL01792:Ift172	APN	5	31276871	missense	probably damaging	1.00
IGL01830:Ift172	APN	5	31285292	missense	probably damaging	1.00
IGL01839:Ift172	APN	5	31266350	missense	probably damaging	1.00
IGL02007:Ift172	APN	5	31286604	missense	probably benign	0.17
IGL02172:Ift172	APN	5	31281337	splice site	probably benign
IGL02190:Ift172	APN	5	31254458	missense	possibly damaging	0.51
IGL02334:Ift172	APN	5	31283058	missense	probably benign	0.00
IGL02486:Ift172	APN	5	31257583	missense	probably damaging	1.00
IGL02517:Ift172	APN	5	31253648	splice site	probably null
IGL02571:Ift172	APN	5	31257891	missense	probably damaging	1.00
IGL02626:Ift172	APN	5	31264496	missense	probably benign
IGL03183:Ift172	APN	5	31272004	missense	probably benign	0.06
IGL03277:Ift172	APN	5	31267298	missense	possibly damaging	0.92
IGL03349:Ift172	APN	5	31284130	missense	probably benign	0.05
ostinato	UTSW	5	31276940	missense	probably benign	0.10
pushback	UTSW	5	31286945	missense	probably damaging	1.00
P0042:Ift172	UTSW	5	31261455	missense	probably benign	0.35
PIT4802001:Ift172	UTSW	5	31285266	missense	probably benign	0.03
R0153:Ift172	UTSW	5	31260624	missense	probably benign
R0328:Ift172	UTSW	5	31263851	nonsense	probably null
R0357:Ift172	UTSW	5	31257900	missense	possibly damaging	0.51
R0369:Ift172	UTSW	5	31253641	missense	probably damaging	1.00
R0391:Ift172	UTSW	5	31286667	missense	probably damaging	1.00
R0512:Ift172	UTSW	5	31285477	missense	possibly damaging	0.92
R0546:Ift172	UTSW	5	31257601	missense	probably benign	0.14
R0553:Ift172	UTSW	5	31275842	splice site	probably benign
R0606:Ift172	UTSW	5	31254313	missense	probably damaging	0.99
R0834:Ift172	UTSW	5	31257371	missense	probably benign
R0973:Ift172	UTSW	5	31265355	missense	probably benign
R0973:Ift172	UTSW	5	31257918	unclassified	probably benign
R1189:Ift172	UTSW	5	31285830	critical splice acceptor site	probably null
R1205:Ift172	UTSW	5	31285792	missense	probably benign
R1289:Ift172	UTSW	5	31280976	missense	probably damaging	0.98
R1342:Ift172	UTSW	5	31261866	missense	probably benign
R1395:Ift172	UTSW	5	31285238	unclassified	probably benign
R1417:Ift172	UTSW	5	31256649	missense	probably damaging	1.00
R2111:Ift172	UTSW	5	31286079	missense	probably benign	0.04
R2175:Ift172	UTSW	5	31266685	missense	probably damaging	1.00
R2509:Ift172	UTSW	5	31262968	missense	probably benign
R2870:Ift172	UTSW	5	31257861	missense	probably benign	0.00
R2870:Ift172	UTSW	5	31257861	missense	probably benign	0.00
R2871:Ift172	UTSW	5	31257861	missense	probably benign	0.00
R2871:Ift172	UTSW	5	31257861	missense	probably benign	0.00
R2872:Ift172	UTSW	5	31257861	missense	probably benign	0.00
R2872:Ift172	UTSW	5	31257861	missense	probably benign	0.00
R3705:Ift172	UTSW	5	31261437	critical splice donor site	probably null
R3793:Ift172	UTSW	5	31257581	missense	possibly damaging	0.61
R4385:Ift172	UTSW	5	31286967	missense	probably damaging	1.00
R4477:Ift172	UTSW	5	31265437	missense	probably benign	0.38
R4590:Ift172	UTSW	5	31253955	missense	probably damaging	1.00
R4663:Ift172	UTSW	5	31284215	missense	probably benign	0.01
R4665:Ift172	UTSW	5	31285254	missense	possibly damaging	0.82
R4977:Ift172	UTSW	5	31272116	missense	possibly damaging	0.79
R5109:Ift172	UTSW	5	31265986	missense	probably benign	0.06
R5182:Ift172	UTSW	5	31267614	missense	possibly damaging	0.51
R5343:Ift172	UTSW	5	31263812	missense	probably benign	0.05
R5465:Ift172	UTSW	5	31261518	splice site	probably null
R5622:Ift172	UTSW	5	31283082	missense	probably damaging	1.00
R5718:Ift172	UTSW	5	31255277	missense	possibly damaging	0.94
R5793:Ift172	UTSW	5	31276948	missense	possibly damaging	0.96
R5870:Ift172	UTSW	5	31276940	missense	probably benign	0.10
R5919:Ift172	UTSW	5	31260662	missense	possibly damaging	0.63
R5968:Ift172	UTSW	5	31261484	missense	probably damaging	1.00
R6112:Ift172	UTSW	5	31256897	missense	probably benign
R6339:Ift172	UTSW	5	31256583	missense	probably benign	0.00
R6339:Ift172	UTSW	5	31286945	missense	probably damaging	1.00
R6355:Ift172	UTSW	5	31284157	missense	probably benign	0.33
R6565:Ift172	UTSW	5	31275883	missense	possibly damaging	0.68
R6668:Ift172	UTSW	5	31255339	missense	probably benign	0.00
R6755:Ift172	UTSW	5	31260998	nonsense	probably null
R6818:Ift172	UTSW	5	31265960	missense	probably benign	0.01
R6939:Ift172	UTSW	5	31257586	missense	probably damaging	1.00
R6980:Ift172	UTSW	5	31257386	missense	probably benign
R7047:Ift172	UTSW	5	31275894	nonsense	probably null
R7156:Ift172	UTSW	5	31272075	missense	probably damaging	1.00
R7180:Ift172	UTSW	5	31254262	missense	probably damaging	1.00
R7288:Ift172	UTSW	5	31285286	missense	probably damaging	1.00
R7351:Ift172	UTSW	5	31275896	missense	probably damaging	1.00
R7706:Ift172	UTSW	5	31266379	nonsense	probably null
R7890:Ift172	UTSW	5	31283081	nonsense	probably null
R7980:Ift172	UTSW	5	31260644	missense	probably benign
R8263:Ift172	UTSW	5	31265337	missense	possibly damaging	0.48
R8559:Ift172	UTSW	5	31256577	missense	probably damaging	0.98
R8717:Ift172	UTSW	5	31255641	missense	probably benign	0.00
R8774:Ift172	UTSW	5	31257863	missense	probably benign	0.45
R8774-TAIL:Ift172	UTSW	5	31257863	missense	probably benign	0.45
R9037:Ift172	UTSW	5	31263056	missense	possibly damaging	0.56
R9038:Ift172	UTSW	5	31284055	missense	possibly damaging	0.53
R9133:Ift172	UTSW	5	31285523	missense	probably benign	0.00
X0022:Ift172	UTSW	5	31285320	missense	probably damaging	0.97
Z1176:Ift172	UTSW	5	31276924	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAAGTCCAAAGGAAGATGTTTGC -3'
(R):5'- GGAATTTCGTGAAACCTCAGG -3'

Sequencing Primer
(F):5'- TTGCCTAAATAAAGATAACACAGAGG -3'
(R):5'- TCAGGCTGCTAAGTCCCTTAAAG -3'

Posted On

2014-08-25