Incidental Mutation 'R2020:Stx18'
ID 223806
Institutional Source Beutler Lab
Gene Symbol Stx18
Ensembl Gene ENSMUSG00000029125
Gene Name syntaxin 18
Synonyms 1810035L21Rik, 4933425D03Rik
MMRRC Submission 040029-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R2020 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 38038742-38137765 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 38135244 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 230 (H230R)
Ref Sequence ENSEMBL: ENSMUSP00000118218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031008] [ENSMUST00000031009] [ENSMUST00000042146] [ENSMUST00000114126] [ENSMUST00000154929] [ENSMUST00000201363] [ENSMUST00000201415]
AlphaFold Q8VDS8
Predicted Effect probably damaging
Transcript: ENSMUST00000031008
AA Change: H284R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000031008
Gene: ENSMUSG00000029125
AA Change: H284R

DomainStartEndE-ValueType
Pfam:Syntaxin-18_N 3 96 4.1e-26 PFAM
low complexity region 196 209 N/A INTRINSIC
coiled coil region 229 259 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000031009
SMART Domains Protein: ENSMUSP00000031009
Gene: ENSMUSG00000029126

DomainStartEndE-ValueType
Pfam:Calcyon 1 180 1.2e-88 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000042146
AA Change: H258R

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000038205
Gene: ENSMUSG00000029125
AA Change: H258R

DomainStartEndE-ValueType
Pfam:Syntaxin-18_N 3 96 4.1e-26 PFAM
low complexity region 170 183 N/A INTRINSIC
coiled coil region 203 233 N/A INTRINSIC
transmembrane domain 284 306 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114126
AA Change: H284R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109761
Gene: ENSMUSG00000029125
AA Change: H284R

DomainStartEndE-ValueType
Pfam:Syntaxin-18_N 3 96 3.4e-24 PFAM
low complexity region 196 209 N/A INTRINSIC
coiled coil region 229 259 N/A INTRINSIC
transmembrane domain 310 332 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141286
Predicted Effect probably damaging
Transcript: ENSMUST00000154929
AA Change: H230R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000118218
Gene: ENSMUSG00000029125
AA Change: H230R

DomainStartEndE-ValueType
low complexity region 142 155 N/A INTRINSIC
coiled coil region 175 205 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201363
SMART Domains Protein: ENSMUSP00000144396
Gene: ENSMUSG00000029126

DomainStartEndE-ValueType
Pfam:Calcyon 1 180 1.2e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201415
SMART Domains Protein: ENSMUSP00000143921
Gene: ENSMUSG00000029126

DomainStartEndE-ValueType
Pfam:Calcyon 1 47 7.5e-19 PFAM
Pfam:Calcyon 43 141 1e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202129
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202512
Meta Mutation Damage Score 0.1287 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.6%
Validation Efficiency 99% (87/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the syntaxin family of soluble N-ethylmaleimide-sensitive factor attachment protein receptors (SNAREs) which is part of a membrane tethering complex that includes other SNAREs and several peripheral membrane proteins, and is involved in vesicular transport between the endoplasmic reticulum (ER) and the Golgi complex. The encoded protein is important for the organization of the smooth, rough, and exit site ER subdomains. A pseudogene of this gene has been identified. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012P17Rik C A 1: 158,968,912 noncoding transcript Het
9530053A07Rik T C 7: 28,155,594 S1882P probably benign Het
Adam17 G A 12: 21,349,875 R177C probably damaging Het
Ak7 G A 12: 105,745,332 probably null Het
Akap9 T C 5: 3,961,967 V890A probably damaging Het
Alg6 A G 4: 99,738,132 N59S probably damaging Het
Alkbh5 G T 11: 60,538,549 A43S probably benign Het
Anxa2 C A 9: 69,483,817 D162E probably damaging Het
Arap1 A G 7: 101,401,518 H1136R probably benign Het
Arhgap18 A G 10: 26,854,904 R121G probably benign Het
Arhgef4 A T 1: 34,723,810 T716S unknown Het
Atg2a T C 19: 6,250,269 probably null Het
Ccdc27 T C 4: 154,033,313 I480V probably null Het
Cdipt T C 7: 126,976,933 V20A possibly damaging Het
Cgrrf1 C T 14: 46,830,445 probably benign Het
Chd7 G A 4: 8,855,226 V2152I probably benign Het
Chd8 T A 14: 52,215,241 S1274C probably damaging Het
Chuk A T 19: 44,107,343 M17K possibly damaging Het
Col14a1 C T 15: 55,446,181 probably benign Het
Col20a1 G A 2: 181,013,163 probably null Het
Cped1 A G 6: 22,143,964 I570V probably benign Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Ddx27 A C 2: 167,033,771 Q674P probably damaging Het
Dennd6a T A 14: 26,612,003 F131L probably damaging Het
Dhx38 G A 8: 109,556,869 probably benign Het
Dido1 G T 2: 180,659,585 N2175K unknown Het
Dmxl1 T A 18: 49,889,558 Y1654* probably null Het
Dock7 T A 4: 98,959,101 H1658L probably damaging Het
Dync2h1 T A 9: 7,122,772 E2061D probably damaging Het
Dync2h1 T C 9: 7,162,925 I555V probably benign Het
Eif2ak2 T C 17: 78,863,963 E337G possibly damaging Het
Fabp12 T A 3: 10,250,149 D46V probably benign Het
Fech C T 18: 64,478,727 E79K probably damaging Het
Flnc A T 6: 29,444,363 I693F probably damaging Het
Foxp2 G A 6: 15,324,644 C97Y possibly damaging Het
Grin2b A G 6: 135,733,896 M884T probably benign Het
Gtf2ird1 T C 5: 134,417,093 D28G probably damaging Het
Gtf3c4 C A 2: 28,833,894 G468W possibly damaging Het
Ift172 A T 5: 31,267,241 L201* probably null Het
Il1rl2 C A 1: 40,365,214 S498R probably damaging Het
Ildr1 C T 16: 36,725,541 R489W probably damaging Het
Itga10 G A 3: 96,652,490 G487D probably damaging Het
Klk8 A G 7: 43,799,216 N128D probably benign Het
Lgr6 G A 1: 135,075,275 T79M probably damaging Het
Med6 T C 12: 81,573,877 T232A probably benign Het
Mgat4e A G 1: 134,541,322 L328P probably damaging Het
Mttp A G 3: 138,118,402 Y138H probably damaging Het
Ngef T C 1: 87,545,968 R31G probably benign Het
Nipsnap2 C A 5: 129,753,223 probably null Het
Nlgn2 G T 11: 69,828,441 N194K probably damaging Het
Olfr1026 A G 2: 85,923,743 I158M probably benign Het
Olfr1245 A T 2: 89,574,961 M255K possibly damaging Het
Olfr1450 G A 19: 12,954,332 V248I possibly damaging Het
Olfr357 G A 2: 36,997,652 V281M possibly damaging Het
Olfr894 A G 9: 38,219,432 Y203C possibly damaging Het
Pcca T A 14: 122,813,222 M101K possibly damaging Het
Plekha6 A G 1: 133,284,970 T671A possibly damaging Het
Prex2 G A 1: 11,162,312 V868M probably damaging Het
Prkcq G A 2: 11,279,521 V501I probably benign Het
Prom1 T A 5: 44,011,253 probably benign Het
Ptprd A G 4: 76,133,161 V41A probably damaging Het
Rab39 C T 9: 53,686,398 G189E possibly damaging Het
Ret T C 6: 118,180,382 K236E possibly damaging Het
Rfx6 G A 10: 51,720,057 probably null Het
Rnf213 A G 11: 119,461,918 T3916A probably damaging Het
Rpn1 A G 6: 88,095,683 N336S probably damaging Het
Sag G A 1: 87,805,315 A2T probably damaging Het
Sco2 T C 15: 89,371,860 Y197C probably damaging Het
Sec23b T C 2: 144,566,944 I183T possibly damaging Het
Sec24b C T 3: 129,987,728 V1166M probably damaging Het
Slc27a5 A T 7: 12,993,412 F361Y probably damaging Het
Spaca9 A G 2: 28,696,001 L17P probably damaging Het
Sqor T C 2: 122,804,107 probably null Het
Tas2r130 A T 6: 131,630,769 I21N probably damaging Het
Tcaf3 A G 6: 42,593,724 S365P possibly damaging Het
Tinagl1 G A 4: 130,166,972 H351Y probably damaging Het
Tmc2 T C 2: 130,232,385 Y333H probably damaging Het
Trp53bp2 A T 1: 182,442,819 T395S probably damaging Het
Tsc22d1 T C 14: 76,418,333 S751P probably damaging Het
Ttc30a1 A G 2: 75,980,935 V268A probably benign Het
Ttn A G 2: 76,827,024 probably benign Het
Ugdh T C 5: 65,416,925 Y425C probably damaging Het
Vmn1r115 G A 7: 20,844,169 L273F probably null Het
Vmn2r109 A T 17: 20,541,186 C636* probably null Het
Vmn2r59 A C 7: 42,043,779 Y466D probably damaging Het
Zic5 C T 14: 122,464,830 G163D unknown Het
Other mutations in Stx18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01782:Stx18 APN 5 38106611 missense possibly damaging 0.86
IGL02123:Stx18 APN 5 38128103 missense probably damaging 1.00
IGL03107:Stx18 APN 5 38136311 missense probably damaging 1.00
IGL03187:Stx18 APN 5 38126983 missense possibly damaging 0.94
R0025:Stx18 UTSW 5 38092564 missense probably damaging 1.00
R0025:Stx18 UTSW 5 38092564 missense probably damaging 1.00
R0414:Stx18 UTSW 5 38105005 splice site probably benign
R0713:Stx18 UTSW 5 38106671 splice site probably null
R1147:Stx18 UTSW 5 38126923 splice site probably benign
R1552:Stx18 UTSW 5 38104991 missense probably damaging 0.99
R1725:Stx18 UTSW 5 38135255 missense probably damaging 1.00
R1929:Stx18 UTSW 5 38128039 splice site probably null
R4678:Stx18 UTSW 5 38136368 unclassified probably benign
R5247:Stx18 UTSW 5 38106633 missense probably damaging 1.00
R6056:Stx18 UTSW 5 38106564 missense probably damaging 0.96
R6330:Stx18 UTSW 5 38126917 splice site probably null
R6860:Stx18 UTSW 5 38104891 missense possibly damaging 0.62
R7060:Stx18 UTSW 5 38121255 missense possibly damaging 0.87
R7285:Stx18 UTSW 5 38104907 missense possibly damaging 0.91
R7351:Stx18 UTSW 5 38039411 missense probably benign 0.00
R8310:Stx18 UTSW 5 38128039 splice site probably null
R8329:Stx18 UTSW 5 38128106 nonsense probably null
X0026:Stx18 UTSW 5 38104966 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTACTTGCTGGCTCTGAGAG -3'
(R):5'- CTGCAAGGTGGACCCTAAACAC -3'

Sequencing Primer
(F):5'- CACTAGCTGTACTTCAGATAATGGGG -3'
(R):5'- CTACACAGTATTCTTGGACAACCTC -3'
Posted On 2014-08-25