Mutagenetix > Incidental Mutation

Incidental Mutation 'R2020:Stx18'

223806

Institutional Source

Beutler Lab

Gene Symbol

Stx18

Ensembl Gene

ENSMUSG00000029125

Gene Name

syntaxin 18

Synonyms

1810035L21Rik, 4933425D03Rik

MMRRC Submission

040029-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2020 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

38038742-38137765 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 38135244 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 230 (H230R)

Ref Sequence

ENSEMBL: ENSMUSP00000118218 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031008] [ENSMUST00000031009] [ENSMUST00000042146] [ENSMUST00000114126] [ENSMUST00000154929] [ENSMUST00000201363] [ENSMUST00000201415]

AlphaFold

Q8VDS8

Predicted Effect

probably damaging
Transcript: ENSMUST00000031008
AA Change: H284R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000031008
Gene: ENSMUSG00000029125
AA Change: H284R

Domain	Start	End	E-Value	Type
Pfam:Syntaxin-18_N	3	96	4.1e-26	PFAM
low complexity region	196	209	N/A	INTRINSIC
coiled coil region	229	259	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000031009

SMART Domains

Protein: ENSMUSP00000031009
Gene: ENSMUSG00000029126

Domain	Start	End	E-Value	Type
Pfam:Calcyon	1	180	1.2e-88	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000042146
AA Change: H258R

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000038205
Gene: ENSMUSG00000029125
AA Change: H258R

Domain	Start	End	E-Value	Type
Pfam:Syntaxin-18_N	3	96	4.1e-26	PFAM
low complexity region	170	183	N/A	INTRINSIC
coiled coil region	203	233	N/A	INTRINSIC
transmembrane domain	284	306	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000114126
AA Change: H284R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000109761
Gene: ENSMUSG00000029125
AA Change: H284R

Domain	Start	End	E-Value	Type
Pfam:Syntaxin-18_N	3	96	3.4e-24	PFAM
low complexity region	196	209	N/A	INTRINSIC
coiled coil region	229	259	N/A	INTRINSIC
transmembrane domain	310	332	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141286

Predicted Effect

probably damaging
Transcript: ENSMUST00000154929
AA Change: H230R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000118218
Gene: ENSMUSG00000029125
AA Change: H230R

Domain	Start	End	E-Value	Type
low complexity region	142	155	N/A	INTRINSIC
coiled coil region	175	205	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000201363

SMART Domains

Protein: ENSMUSP00000144396
Gene: ENSMUSG00000029126

Domain	Start	End	E-Value	Type
Pfam:Calcyon	1	180	1.2e-88	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000201415

SMART Domains

Protein: ENSMUSP00000143921
Gene: ENSMUSG00000029126

Domain	Start	End	E-Value	Type
Pfam:Calcyon	1	47	7.5e-19	PFAM
Pfam:Calcyon	43	141	1e-44	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000202129

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202512

Meta Mutation Damage Score

0.1287

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 93.6%

Validation Efficiency

99% (87/88)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the syntaxin family of soluble N-ethylmaleimide-sensitive factor attachment protein receptors (SNAREs) which is part of a membrane tethering complex that includes other SNAREs and several peripheral membrane proteins, and is involved in vesicular transport between the endoplasmic reticulum (ER) and the Golgi complex. The encoded protein is important for the organization of the smooth, rough, and exit site ER subdomains. A pseudogene of this gene has been identified. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2016]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600012P17Rik	C	A	1: 158,968,912		noncoding transcript	Het
9530053A07Rik	T	C	7: 28,155,594	S1882P	probably benign	Het
Adam17	G	A	12: 21,349,875	R177C	probably damaging	Het
Ak7	G	A	12: 105,745,332		probably null	Het
Akap9	T	C	5: 3,961,967	V890A	probably damaging	Het
Alg6	A	G	4: 99,738,132	N59S	probably damaging	Het
Alkbh5	G	T	11: 60,538,549	A43S	probably benign	Het
Anxa2	C	A	9: 69,483,817	D162E	probably damaging	Het
Arap1	A	G	7: 101,401,518	H1136R	probably benign	Het
Arhgap18	A	G	10: 26,854,904	R121G	probably benign	Het
Arhgef4	A	T	1: 34,723,810	T716S	unknown	Het
Atg2a	T	C	19: 6,250,269		probably null	Het
Ccdc27	T	C	4: 154,033,313	I480V	probably null	Het
Cdipt	T	C	7: 126,976,933	V20A	possibly damaging	Het
Cgrrf1	C	T	14: 46,830,445		probably benign	Het
Chd7	G	A	4: 8,855,226	V2152I	probably benign	Het
Chd8	T	A	14: 52,215,241	S1274C	probably damaging	Het
Chuk	A	T	19: 44,107,343	M17K	possibly damaging	Het
Col14a1	C	T	15: 55,446,181		probably benign	Het
Col20a1	G	A	2: 181,013,163		probably null	Het
Cped1	A	G	6: 22,143,964	I570V	probably benign	Het
Cul9	C	G	17: 46,522,175	A1326P	probably damaging	Het
Ddx27	A	C	2: 167,033,771	Q674P	probably damaging	Het
Dennd6a	T	A	14: 26,612,003	F131L	probably damaging	Het
Dhx38	G	A	8: 109,556,869		probably benign	Het
Dido1	G	T	2: 180,659,585	N2175K	unknown	Het
Dmxl1	T	A	18: 49,889,558	Y1654*	probably null	Het
Dock7	T	A	4: 98,959,101	H1658L	probably damaging	Het
Dync2h1	T	A	9: 7,122,772	E2061D	probably damaging	Het
Dync2h1	T	C	9: 7,162,925	I555V	probably benign	Het
Eif2ak2	T	C	17: 78,863,963	E337G	possibly damaging	Het
Fabp12	T	A	3: 10,250,149	D46V	probably benign	Het
Fech	C	T	18: 64,478,727	E79K	probably damaging	Het
Flnc	A	T	6: 29,444,363	I693F	probably damaging	Het
Foxp2	G	A	6: 15,324,644	C97Y	possibly damaging	Het
Grin2b	A	G	6: 135,733,896	M884T	probably benign	Het
Gtf2ird1	T	C	5: 134,417,093	D28G	probably damaging	Het
Gtf3c4	C	A	2: 28,833,894	G468W	possibly damaging	Het
Ift172	A	T	5: 31,267,241	L201*	probably null	Het
Il1rl2	C	A	1: 40,365,214	S498R	probably damaging	Het
Ildr1	C	T	16: 36,725,541	R489W	probably damaging	Het
Itga10	G	A	3: 96,652,490	G487D	probably damaging	Het
Klk8	A	G	7: 43,799,216	N128D	probably benign	Het
Lgr6	G	A	1: 135,075,275	T79M	probably damaging	Het
Med6	T	C	12: 81,573,877	T232A	probably benign	Het
Mgat4e	A	G	1: 134,541,322	L328P	probably damaging	Het
Mttp	A	G	3: 138,118,402	Y138H	probably damaging	Het
Ngef	T	C	1: 87,545,968	R31G	probably benign	Het
Nipsnap2	C	A	5: 129,753,223		probably null	Het
Nlgn2	G	T	11: 69,828,441	N194K	probably damaging	Het
Olfr1026	A	G	2: 85,923,743	I158M	probably benign	Het
Olfr1245	A	T	2: 89,574,961	M255K	possibly damaging	Het
Olfr1450	G	A	19: 12,954,332	V248I	possibly damaging	Het
Olfr357	G	A	2: 36,997,652	V281M	possibly damaging	Het
Olfr894	A	G	9: 38,219,432	Y203C	possibly damaging	Het
Pcca	T	A	14: 122,813,222	M101K	possibly damaging	Het
Plekha6	A	G	1: 133,284,970	T671A	possibly damaging	Het
Prex2	G	A	1: 11,162,312	V868M	probably damaging	Het
Prkcq	G	A	2: 11,279,521	V501I	probably benign	Het
Prom1	T	A	5: 44,011,253		probably benign	Het
Ptprd	A	G	4: 76,133,161	V41A	probably damaging	Het
Rab39	C	T	9: 53,686,398	G189E	possibly damaging	Het
Ret	T	C	6: 118,180,382	K236E	possibly damaging	Het
Rfx6	G	A	10: 51,720,057		probably null	Het
Rnf213	A	G	11: 119,461,918	T3916A	probably damaging	Het
Rpn1	A	G	6: 88,095,683	N336S	probably damaging	Het
Sag	G	A	1: 87,805,315	A2T	probably damaging	Het
Sco2	T	C	15: 89,371,860	Y197C	probably damaging	Het
Sec23b	T	C	2: 144,566,944	I183T	possibly damaging	Het
Sec24b	C	T	3: 129,987,728	V1166M	probably damaging	Het
Slc27a5	A	T	7: 12,993,412	F361Y	probably damaging	Het
Spaca9	A	G	2: 28,696,001	L17P	probably damaging	Het
Sqor	T	C	2: 122,804,107		probably null	Het
Tas2r130	A	T	6: 131,630,769	I21N	probably damaging	Het
Tcaf3	A	G	6: 42,593,724	S365P	possibly damaging	Het
Tinagl1	G	A	4: 130,166,972	H351Y	probably damaging	Het
Tmc2	T	C	2: 130,232,385	Y333H	probably damaging	Het
Trp53bp2	A	T	1: 182,442,819	T395S	probably damaging	Het
Tsc22d1	T	C	14: 76,418,333	S751P	probably damaging	Het
Ttc30a1	A	G	2: 75,980,935	V268A	probably benign	Het
Ttn	A	G	2: 76,827,024		probably benign	Het
Ugdh	T	C	5: 65,416,925	Y425C	probably damaging	Het
Vmn1r115	G	A	7: 20,844,169	L273F	probably null	Het
Vmn2r109	A	T	17: 20,541,186	C636*	probably null	Het
Vmn2r59	A	C	7: 42,043,779	Y466D	probably damaging	Het
Zic5	C	T	14: 122,464,830	G163D	unknown	Het

Other mutations in Stx18

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01782:Stx18	APN	5	38106611	missense	possibly damaging	0.86
IGL02123:Stx18	APN	5	38128103	missense	probably damaging	1.00
IGL03107:Stx18	APN	5	38136311	missense	probably damaging	1.00
IGL03187:Stx18	APN	5	38126983	missense	possibly damaging	0.94
R0025:Stx18	UTSW	5	38092564	missense	probably damaging	1.00
R0025:Stx18	UTSW	5	38092564	missense	probably damaging	1.00
R0414:Stx18	UTSW	5	38105005	splice site	probably benign
R0713:Stx18	UTSW	5	38106671	splice site	probably null
R1147:Stx18	UTSW	5	38126923	splice site	probably benign
R1552:Stx18	UTSW	5	38104991	missense	probably damaging	0.99
R1725:Stx18	UTSW	5	38135255	missense	probably damaging	1.00
R1929:Stx18	UTSW	5	38128039	splice site	probably null
R4678:Stx18	UTSW	5	38136368	unclassified	probably benign
R5247:Stx18	UTSW	5	38106633	missense	probably damaging	1.00
R6056:Stx18	UTSW	5	38106564	missense	probably damaging	0.96
R6330:Stx18	UTSW	5	38126917	splice site	probably null
R6860:Stx18	UTSW	5	38104891	missense	possibly damaging	0.62
R7060:Stx18	UTSW	5	38121255	missense	possibly damaging	0.87
R7285:Stx18	UTSW	5	38104907	missense	possibly damaging	0.91
R7351:Stx18	UTSW	5	38039411	missense	probably benign	0.00
R8310:Stx18	UTSW	5	38128039	splice site	probably null
R8329:Stx18	UTSW	5	38128106	nonsense	probably null
R9585:Stx18	UTSW	5	38092572	missense	possibly damaging	0.79
R9784:Stx18	UTSW	5	38039291	start gained	probably benign
X0026:Stx18	UTSW	5	38104966	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ACTACTTGCTGGCTCTGAGAG -3'
(R):5'- CTGCAAGGTGGACCCTAAACAC -3'

Sequencing Primer
(F):5'- CACTAGCTGTACTTCAGATAATGGGG -3'
(R):5'- CTACACAGTATTCTTGGACAACCTC -3'

Posted On

2014-08-25