Mutagenetix > Incidental Mutations

Incidental Mutation 'R1993:Cacna1e'

223809

Institutional Source

Beutler Lab

Gene Symbol

Cacna1e

Ensembl Gene

ENSMUSG00000004110

Gene Name

calcium channel, voltage-dependent, R type, alpha 1E subunit

Synonyms

Cchra1, alpha1E, Cav2.3

MMRRC Submission

040004-MU

Accession Numbers

Genbank: NM_009782; MGI: 106217

Is this an essential gene?

Probably non essential (E-score: 0.187) question?

Stock #

R1993 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

154390731-154884501 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 154477817 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 423 (Q423L)

Ref Sequence

ENSEMBL: ENSMUSP00000004214 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004214] [ENSMUST00000187541] [ENSMUST00000211821]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000004214
AA Change: Q423L

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000004214
Gene: ENSMUSG00000004110
AA Change: Q423L

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	1	55	6.7e-10	PFAM
Pfam:Ion_trans	168	407	3.3e-56	PFAM
Pfam:PKD_channel	257	401	3.3e-7	PFAM
low complexity region	409	414	N/A	INTRINSIC
low complexity region	455	469	N/A	INTRINSIC
low complexity region	496	514	N/A	INTRINSIC
low complexity region	604	620	N/A	INTRINSIC
low complexity region	626	640	N/A	INTRINSIC
coiled coil region	793	823	N/A	INTRINSIC
Pfam:Ion_trans	847	1128	2.3e-63	PFAM
Pfam:Ion_trans	1172	1429	2.6e-65	PFAM
Pfam:PKD_channel	1256	1424	2.8e-10	PFAM
Pfam:GPHH	1431	1500	1.3e-37	PFAM
Ca_chan_IQ	1555	1589	5.93e-13	SMART
low complexity region	1701	1717	N/A	INTRINSIC
low complexity region	1729	1742	N/A	INTRINSIC
low complexity region	1764	1780	N/A	INTRINSIC
low complexity region	1789	1804	N/A	INTRINSIC
low complexity region	1808	1822	N/A	INTRINSIC
low complexity region	1832	1846	N/A	INTRINSIC
low complexity region	1867	1878	N/A	INTRINSIC
low complexity region	1936	1946	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000187541
AA Change: Q731L

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000140937
Gene: ENSMUSG00000004110
AA Change: Q731L

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	128	351	8.5e-54	PFAM
PDB:4DEX\|B	354	462	6e-36	PDB
Pfam:Ion_trans	511	703	2.2e-46	PFAM
Pfam:PKD_channel	565	710	1.4e-6	PFAM
low complexity region	717	722	N/A	INTRINSIC
low complexity region	763	777	N/A	INTRINSIC
low complexity region	804	822	N/A	INTRINSIC
low complexity region	912	928	N/A	INTRINSIC
low complexity region	934	948	N/A	INTRINSIC
coiled coil region	1101	1131	N/A	INTRINSIC
low complexity region	1162	1175	N/A	INTRINSIC
Pfam:Ion_trans	1191	1425	4.3e-55	PFAM
Pfam:Ion_trans	1515	1725	5.3e-60	PFAM
Pfam:PKD_channel	1565	1732	4.7e-10	PFAM
Ca_chan_IQ	1863	1897	5.93e-13	SMART
low complexity region	2009	2025	N/A	INTRINSIC
low complexity region	2037	2050	N/A	INTRINSIC
low complexity region	2072	2088	N/A	INTRINSIC
low complexity region	2097	2112	N/A	INTRINSIC
low complexity region	2116	2130	N/A	INTRINSIC
low complexity region	2140	2154	N/A	INTRINSIC
low complexity region	2175	2186	N/A	INTRINSIC
low complexity region	2244	2254	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188384

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188965

Predicted Effect

probably damaging
Transcript: ENSMUST00000211821
AA Change: Q669L

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.3%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes an integral membrane protein that belongs to the calcium channel alpha-1 subunits family. Voltage-sensitive calcium channels mediate the entry of calcium ions into excitable cells and are also involved in a variety of calcium-dependent processes. Voltage-dependent calcium channels are multi-subunit complexes, comprised of alpha-1, alpha-2, beta and delta subunits in a 1:1:1:1 ratio. The isoform alpha-1E gives rise to R-type calcium currents and belongs to the high-voltage activated group. Calcium channels containing the alpha-1E subunit may be involved in the modulation of neuronal firing patterns, an important component of information processing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit altered R-type Ca2+ channels, increased timidity and body weight, impaired glucose tolerance, reduced locomotor activity, and lack of the cocaine stimulation of locomotor response. [provided by MGI curators]

Allele List at MGI

All alleles(7) : Targeted, knock-out(3) Targeted, other(3) Gene trapped(1)

Other mutations in this stock

Total: 104 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb1b	T	G	5: 8,821,322	I292S	possibly damaging	Het
Abcc4	T	C	14: 118,526,282	N1047S	probably benign	Het
Abcc8	G	T	7: 46,117,423		probably null	Het
Akap9	T	A	5: 4,038,520		probably null	Het
Alox5	T	A	6: 116,415,463	I366F	probably damaging	Het
Amn	A	G	12: 111,276,092	N447S	probably damaging	Het
Ankrd22	A	T	19: 34,165,774	M1K	probably null	Het
Asic1	G	T	15: 99,671,884	G29C	probably damaging	Het
Atxn7l1	A	G	12: 33,345,977	N235S	probably benign	Het
AY358078	T	A	14: 51,826,062	D388E	probably damaging	Het
Bod1l	A	G	5: 41,817,336	S2212P	probably damaging	Het
Calu	T	C	6: 29,366,975	I62T	possibly damaging	Het
Cars2	A	G	8: 11,514,515	V75A	probably benign	Het
Catsperb	T	A	12: 101,602,767	N899K	possibly damaging	Het
Ccdc50	T	A	16: 27,409,339	C86*	probably null	Het
Cdh5	G	T	8: 104,137,815	L469F	probably damaging	Het
Clrn3	A	T	7: 135,514,119	D167E	probably benign	Het
Csmd1	A	T	8: 16,346,684	C411S	probably damaging	Het
Dchs1	A	T	7: 105,762,548	S1454T	probably benign	Het
Ddx20	G	A	3: 105,679,344	Q562*	probably null	Het
Dgkg	T	G	16: 22,600,594	Y52S	probably damaging	Het
Dhx58	T	C	11: 100,703,490		probably null	Het
Dpp6	A	T	5: 27,399,006	I145L	probably benign	Het
Efna2	A	T	10: 80,186,877	Y85F	possibly damaging	Het
Eif3a	C	T	19: 60,781,516	V127I	probably benign	Het
Exph5	A	T	9: 53,373,635	H672L	possibly damaging	Het
Fam131b	T	C	6: 42,320,884	T112A	possibly damaging	Het
Fam71e2	A	T	7: 4,758,018	V565E	probably damaging	Het
Fcgr1	A	T	3: 96,285,868	V271E	probably damaging	Het
Fgfr4	A	G	13: 55,165,902	D508G	probably damaging	Het
Fndc3b	A	G	3: 27,419,400	M1172T	probably benign	Het
Fryl	G	T	5: 73,108,493	T495K	probably damaging	Het
Gm5134	A	T	10: 75,966,393	I93F	probably damaging	Het
Gpbar1	G	A	1: 74,279,444	G282D	possibly damaging	Het
Gria2	G	A	3: 80,802,357	L10F	probably benign	Het
Grm7	T	C	6: 111,207,808	Y367H	probably benign	Het
Hils1	T	A	11: 94,968,032	V51E	probably damaging	Het
Hivep1	G	A	13: 42,157,493	A1070T	probably benign	Het
Il33	A	G	19: 29,956,904	D155G	possibly damaging	Het
Kdm6b	T	C	11: 69,406,303	S408G	probably null	Het
Kntc1	G	A	5: 123,759,099		probably null	Het
Kntc1	A	G	5: 123,810,811		probably null	Het
Ltbp2	T	G	12: 84,808,446		probably null	Het
Mapk8ip3	G	T	17: 24,914,588	L83I	probably damaging	Het
Meltf	C	A	16: 31,892,622	Y554*	probably null	Het
Mov10	A	C	3: 104,799,419	F725C	probably damaging	Het
Ms4a6d	A	C	19: 11,590,159	L18R	probably damaging	Het
Naip2	T	C	13: 100,162,007	N507S	probably benign	Het
Nodal	A	G	10: 61,418,334	Q12R	probably benign	Het
Npy6r	T	C	18: 44,276,508	L332P	probably damaging	Het
Nrxn3	A	G	12: 89,260,411	K272R	possibly damaging	Het
Obox2	G	T	7: 15,397,249	K93N	probably benign	Het
Olfr1136	C	T	2: 87,693,433	V150M	probably benign	Het
Olfr1408	C	T	1: 173,130,851	R122H	possibly damaging	Het
Olfr1466	A	G	19: 13,341,814	T19A	possibly damaging	Het
Olfr575	G	T	7: 102,954,746	P285Q	probably damaging	Het
Pcdh12	T	A	18: 38,282,143	D643V	possibly damaging	Het
Pcsk2	A	G	2: 143,687,619	D112G	probably benign	Het
Pms1	A	G	1: 53,195,015	S781P	probably benign	Het
Prtg	A	G	9: 72,844,896	D188G	probably benign	Het
Psg21	A	T	7: 18,654,770	N132K	probably benign	Het
Psip1	A	G	4: 83,482,532	V25A	probably damaging	Het
Psmd13	T	A	7: 140,898,194	I319N	probably damaging	Het
Ptges2	A	G	2: 32,400,092	T173A	probably benign	Het
Ptprm	G	A	17: 66,747,160	R975W	probably damaging	Het
Rdh1	A	G	10: 127,765,345	D254G	probably benign	Het
Rnf138	T	G	18: 21,024,483	N212K	probably damaging	Het
Serpine2	A	G	1: 79,821,442	S32P	probably damaging	Het
Serpini1	G	T	3: 75,614,664	W154L	probably damaging	Het
Sf3a1	C	A	11: 4,179,177	Q713K	possibly damaging	Het
Sgo2b	A	T	8: 63,926,833	H988Q	probably benign	Het
Sin3a	T	C	9: 57,101,199	F468L	probably damaging	Het
Slamf6	A	T	1: 171,934,209	I66F	possibly damaging	Het
Slc22a28	A	T	19: 8,117,124	C178S	possibly damaging	Het
Slc35a1	A	C	4: 34,675,181	V119G	probably damaging	Het
Slc39a12	A	T	2: 14,434,219	H428L	probably damaging	Het
Speer2	A	G	16: 69,858,077	S167P	probably benign	Het
Sphkap	G	A	1: 83,277,515	R838*	probably null	Het
Spsb2	T	C	6: 124,809,366		probably null	Het
Stam2	A	T	2: 52,703,156	Y341*	probably null	Het
Sv2b	G	A	7: 75,206,341	A67V	probably benign	Het
Svep1	A	G	4: 58,064,170		probably null	Het
Syt15	A	T	14: 34,223,012	Q172L	probably benign	Het
T	G	A	17: 8,441,802	S415N	probably benign	Het
Tep1	A	G	14: 50,824,184	F2625S	possibly damaging	Het
Tex14	T	C	11: 87,536,755	V11A	possibly damaging	Het
Tiam2	A	T	17: 3,415,126	R377*	probably null	Het
Tirap	A	G	9: 35,191,016		probably null	Het
Tm4sf20	T	C	1: 82,760,217	T118A	probably benign	Het
Trank1	A	T	9: 111,378,832	Q1715L	probably benign	Het
Trpm2	C	T	10: 77,947,989	V217M	probably damaging	Het
Ubap1l	G	A	9: 65,371,796	E126K	possibly damaging	Het
Urgcp	G	T	11: 5,716,526	P604Q	probably damaging	Het
Vmn1r63	A	G	7: 5,803,255	V126A	probably benign	Het
Vmn2r90	T	C	17: 17,713,263	C362R	probably damaging	Het
Vmn2r96	A	G	17: 18,583,876	I271V	probably damaging	Het
Vps13a	A	T	19: 16,722,458	I740K	probably benign	Het
Vps13c	A	G	9: 67,975,856	T3562A	probably damaging	Het
Wdr91	T	A	6: 34,892,362	H409L	probably damaging	Het
Wnt7a	T	A	6: 91,365,956	T315S	possibly damaging	Het
Zfp616	A	G	11: 74,084,969	H688R	probably benign	Het
Zfp763	A	T	17: 33,018,439	H577Q	probably damaging	Het
Zfp808	G	A	13: 62,172,907	S650N	probably benign	Het
Zfp977	A	T	7: 42,579,985	M372K	probably benign	Het

Other mutations in Cacna1e

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00551:Cacna1e	APN	1	154403683	missense	probably damaging	0.99
IGL01086:Cacna1e	APN	1	154471601	missense	probably benign	0.04
IGL01302:Cacna1e	APN	1	154443907	missense	probably damaging	1.00
IGL01386:Cacna1e	APN	1	154472377	missense	probably benign	0.18
IGL01573:Cacna1e	APN	1	154471367	missense	probably benign
IGL01676:Cacna1e	APN	1	154398476	missense	probably damaging	1.00
IGL01676:Cacna1e	APN	1	154412450	missense	probably damaging	1.00
IGL01762:Cacna1e	APN	1	154471373	missense	possibly damaging	0.78
IGL01801:Cacna1e	APN	1	154471340	missense	probably null	0.00
IGL01895:Cacna1e	APN	1	154443900	missense	probably damaging	1.00
IGL02391:Cacna1e	APN	1	154421113	missense	probably damaging	1.00
IGL02399:Cacna1e	APN	1	154403747	missense	probably damaging	1.00
IGL02659:Cacna1e	APN	1	154426528	missense	probably damaging	1.00
IGL02686:Cacna1e	APN	1	154493409	missense	probably damaging	1.00
IGL02838:Cacna1e	APN	1	154445648	missense	probably damaging	1.00
IGL02958:Cacna1e	APN	1	154465741	missense	probably damaging	1.00
IGL02981:Cacna1e	APN	1	154471425	missense	probably benign	0.15
IGL03120:Cacna1e	APN	1	154443881	missense	probably damaging	1.00
IGL03232:Cacna1e	APN	1	154493358	missense	probably damaging	1.00
IGL03310:Cacna1e	APN	1	154442251	missense	probably damaging	1.00
IGL03342:Cacna1e	APN	1	154466944	critical splice donor site	probably null
bezoar	UTSW	1	154436554	splice site	probably null
hairball	UTSW	1	154479305	missense	probably damaging	0.97
N/A - 535:Cacna1e	UTSW	1	154465764	missense	probably damaging	1.00
R0122:Cacna1e	UTSW	1	154443901	missense	probably damaging	1.00
R0143:Cacna1e	UTSW	1	154448947	splice site	probably null
R0314:Cacna1e	UTSW	1	154442251	missense	probably damaging	1.00
R0366:Cacna1e	UTSW	1	154416138	missense	probably benign	0.03
R0626:Cacna1e	UTSW	1	154488817	missense	probably damaging	0.99
R0739:Cacna1e	UTSW	1	154442278	missense	probably damaging	0.97
R1272:Cacna1e	UTSW	1	154444968	missense	probably damaging	1.00
R1300:Cacna1e	UTSW	1	154398673	missense	probably benign
R1340:Cacna1e	UTSW	1	154472657	missense	probably damaging	1.00
R1440:Cacna1e	UTSW	1	154561806	missense	possibly damaging	0.63
R1449:Cacna1e	UTSW	1	154485662	critical splice donor site	probably null
R1538:Cacna1e	UTSW	1	154561758	missense	probably damaging	0.99
R1542:Cacna1e	UTSW	1	154477779	missense	probably benign	0.01
R1560:Cacna1e	UTSW	1	154421104	nonsense	probably null
R1748:Cacna1e	UTSW	1	154486569	missense	possibly damaging	0.92
R1749:Cacna1e	UTSW	1	154444000	missense	probably damaging	1.00
R1912:Cacna1e	UTSW	1	154436449	missense	probably damaging	1.00
R1968:Cacna1e	UTSW	1	154700494	missense	probably damaging	1.00
R1994:Cacna1e	UTSW	1	154477817	missense	probably damaging	0.97
R2191:Cacna1e	UTSW	1	154443845	missense	probably damaging	1.00
R2291:Cacna1e	UTSW	1	154403683	missense	probably damaging	0.99
R2417:Cacna1e	UTSW	1	154472193	missense	probably damaging	1.00
R3608:Cacna1e	UTSW	1	154416085	missense	probably benign	0.08
R3757:Cacna1e	UTSW	1	154633696	missense	probably damaging	0.97
R3890:Cacna1e	UTSW	1	154483553	missense	probably damaging	1.00
R4015:Cacna1e	UTSW	1	154482585	missense	probably damaging	1.00
R4088:Cacna1e	UTSW	1	154412183	splice site	probably null
R4275:Cacna1e	UTSW	1	154493325	missense	probably damaging	1.00
R4282:Cacna1e	UTSW	1	154426550	missense	probably benign	0.04
R4297:Cacna1e	UTSW	1	154398731	missense	probably benign	0.37
R4356:Cacna1e	UTSW	1	154443981	missense	probably damaging	1.00
R4510:Cacna1e	UTSW	1	154561833	missense	probably damaging	1.00
R4511:Cacna1e	UTSW	1	154561833	missense	probably damaging	1.00
R4577:Cacna1e	UTSW	1	154402027	missense	possibly damaging	0.92
R4590:Cacna1e	UTSW	1	154436519	missense	possibly damaging	0.87
R4601:Cacna1e	UTSW	1	154471613	missense	probably benign
R4622:Cacna1e	UTSW	1	154471565	missense	possibly damaging	0.81
R4626:Cacna1e	UTSW	1	154482548	splice site	probably null
R4694:Cacna1e	UTSW	1	154437266	critical splice donor site	probably null
R4727:Cacna1e	UTSW	1	154436468	nonsense	probably null
R4839:Cacna1e	UTSW	1	154421058	missense	probably damaging	1.00
R4851:Cacna1e	UTSW	1	154436554	splice site	probably null
R4894:Cacna1e	UTSW	1	154488805	nonsense	probably null
R4934:Cacna1e	UTSW	1	154481634	nonsense	probably null
R4979:Cacna1e	UTSW	1	154413993	missense	probably damaging	1.00
R5077:Cacna1e	UTSW	1	154561729	critical splice donor site	probably null
R5128:Cacna1e	UTSW	1	154402021	missense	probably damaging	0.98
R5214:Cacna1e	UTSW	1	154701364	missense	possibly damaging	0.93
R5274:Cacna1e	UTSW	1	154700504	missense	probably damaging	0.98
R5388:Cacna1e	UTSW	1	154477796	missense	probably damaging	1.00
R5416:Cacna1e	UTSW	1	154465779	missense	probably damaging	1.00
R5469:Cacna1e	UTSW	1	154443937	missense	probably damaging	1.00
R5475:Cacna1e	UTSW	1	154725709	missense	possibly damaging	0.53
R5607:Cacna1e	UTSW	1	154471340	missense	probably benign	0.00
R5615:Cacna1e	UTSW	1	154412170	missense	probably damaging	1.00
R5616:Cacna1e	UTSW	1	154442194	missense	probably damaging	1.00
R5627:Cacna1e	UTSW	1	154635858	missense	probably damaging	0.98
R5707:Cacna1e	UTSW	1	154633717	missense	probably damaging	1.00
R5756:Cacna1e	UTSW	1	154471637	missense	probably benign	0.00
R5893:Cacna1e	UTSW	1	154437323	missense	probably damaging	1.00
R6117:Cacna1e	UTSW	1	154561791	missense	possibly damaging	0.68
R6134:Cacna1e	UTSW	1	154701291	missense	probably damaging	1.00
R6190:Cacna1e	UTSW	1	154486570	missense	possibly damaging	0.47
R6279:Cacna1e	UTSW	1	154425932	missense	probably benign	0.38
R6295:Cacna1e	UTSW	1	154442173	missense	probably damaging	0.98
R6300:Cacna1e	UTSW	1	154425932	missense	probably benign	0.38
R6320:Cacna1e	UTSW	1	154441524	missense	possibly damaging	0.76
R6375:Cacna1e	UTSW	1	154479305	missense	probably damaging	0.97
R6830:Cacna1e	UTSW	1	154413974	critical splice donor site	probably null
R6842:Cacna1e	UTSW	1	154483117	missense	probably damaging	1.00
R7023:Cacna1e	UTSW	1	154725693	missense	probably null	0.85
R7081:Cacna1e	UTSW	1	154700383	missense	possibly damaging	0.82
R7085:Cacna1e	UTSW	1	154473746	splice site	probably null
R7108:Cacna1e	UTSW	1	154468995	frame shift	probably null
R7142:Cacna1e	UTSW	1	154412484	missense	probably damaging	1.00
R7250:Cacna1e	UTSW	1	154700489	missense	possibly damaging	0.93
R7332:Cacna1e	UTSW	1	154725801	missense	possibly damaging	0.89
R7410:Cacna1e	UTSW	1	154472234	missense	probably benign	0.13
R7502:Cacna1e	UTSW	1	154468988	missense	probably null	0.35
R7556:Cacna1e	UTSW	1	154472673	missense	probably benign	0.28
R7563:Cacna1e	UTSW	1	154471416	missense	probably benign	0.00
R7573:Cacna1e	UTSW	1	154726165	intron	probably benign
R7689:Cacna1e	UTSW	1	154398803	missense	probably benign	0.01
R7699:Cacna1e	UTSW	1	154443928	missense	probably damaging	1.00
R7744:Cacna1e	UTSW	1	154465792	missense	probably damaging	1.00
R7754:Cacna1e	UTSW	1	154413117	missense	probably damaging	0.97
R7787:Cacna1e	UTSW	1	154482568	missense	probably damaging	0.98
R7818:Cacna1e	UTSW	1	154398406	missense	probably damaging	1.00
R7838:Cacna1e	UTSW	1	154471403	missense	probably benign	0.08
R7849:Cacna1e	UTSW	1	154633718	missense	probably damaging	1.00
R8011:Cacna1e	UTSW	1	154465822	missense	probably benign	0.01
R8094:Cacna1e	UTSW	1	154561770	missense	probably damaging	1.00
R8162:Cacna1e	UTSW	1	154701567	splice site	probably null
R8202:Cacna1e	UTSW	1	154398449	missense	probably benign
R8280:Cacna1e	UTSW	1	154469093	missense	probably damaging	0.97
R8354:Cacna1e	UTSW	1	154398568	missense	probably damaging	1.00
R8385:Cacna1e	UTSW	1	154443941	missense	probably damaging	0.98
R8532:Cacna1e	UTSW	1	154465764	missense	probably damaging	1.00
R8902:Cacna1e	UTSW	1	154473886	missense	probably benign	0.01
R8926:Cacna1e	UTSW	1	154701334	missense	possibly damaging	0.84
R8947:Cacna1e	UTSW	1	154402150	missense	probably benign	0.10
R9094:Cacna1e	UTSW	1	154479318	missense	possibly damaging	0.93
R9126:Cacna1e	UTSW	1	154467764	missense	probably benign	0.01
R9175:Cacna1e	UTSW	1	154398568	missense	probably damaging	1.00
R9286:Cacna1e	UTSW	1	154413099	missense	probably damaging	1.00
R9377:Cacna1e	UTSW	1	154485712	missense	possibly damaging	0.88
RF008:Cacna1e	UTSW	1	154442136	missense	probably damaging	1.00
X0062:Cacna1e	UTSW	1	154412492	missense	probably damaging	1.00
Z1176:Cacna1e	UTSW	1	154635850	missense	probably damaging	0.98
Z1177:Cacna1e	UTSW	1	154442292	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCACTATGCACTGTGACCAG -3'
(R):5'- AGAAATGAGACCTCTGCCTAGG -3'

Sequencing Primer
(F):5'- CTGTGACCAGTTCATAGAACAGAAG -3'
(R):5'- TGAGACCTCTGCCTAGGAACTC -3'

Posted On

2014-08-25