Mutagenetix > Incidental Mutations

Incidental Mutation 'R1993:Slamf6'

223811

Institutional Source

Beutler Lab

Gene Symbol

Slamf6

Ensembl Gene

ENSMUSG00000015314

Gene Name

SLAM family member 6

Synonyms

Ly108, SF2000, KAL1, KAL1b, NTB-A

MMRRC Submission

040004-MU

Accession Numbers

NCBI RefSeq: NM_030710.2; MGI:1353620

Is this an essential gene?

Probably non essential (E-score: 0.053) question?

Stock #

R1993 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

171917515-171953170 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 171934209 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 66 (I66F)

Ref Sequence

ENSEMBL: ENSMUSP00000141448 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000171330] [ENSMUST00000194182] [ENSMUST00000194561] [ENSMUST00000195656]

AlphaFold

Q9ET39

Predicted Effect

possibly damaging
Transcript: ENSMUST00000171330
AA Change: I66F

PolyPhen 2 Score 0.742 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000130610
Gene: ENSMUSG00000015314
AA Change: I66F

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
low complexity region	28	37	N/A	INTRINSIC
IG	39	142	1.49e-2	SMART
low complexity region	145	161	N/A	INTRINSIC
Blast:IG_like	162	226	7e-16	BLAST
transmembrane domain	240	262	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193311

Predicted Effect

probably benign
Transcript: ENSMUST00000194182

SMART Domains

Protein: ENSMUSP00000142242
Gene: ENSMUSG00000015314

Domain	Start	End	E-Value	Type
low complexity region	22	36	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000194561
AA Change: I66F

PolyPhen 2 Score 0.742 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000141944
Gene: ENSMUSG00000015314
AA Change: I66F

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
low complexity region	28	37	N/A	INTRINSIC
IG	39	142	1.49e-2	SMART
low complexity region	145	161	N/A	INTRINSIC
Blast:IG_like	162	226	5e-16	BLAST
transmembrane domain	240	262	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000195656
AA Change: I66F

PolyPhen 2 Score 0.742 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000141448
Gene: ENSMUSG00000015314
AA Change: I66F

Domain	Start	End	E-Value	Type
low complexity region	28	37	N/A	INTRINSIC
IG	39	142	5.9e-5	SMART
low complexity region	145	161	N/A	INTRINSIC
Blast:IG_like	162	226	8e-16	BLAST
transmembrane domain	240	262	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.3%

Validation Efficiency

MGI Phenotype

Strain: 3581614
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type I transmembrane protein, belonging to the CD2 subfamily of the immunoglobulin superfamily. This encoded protein is expressed on Natural killer (NK), T, and B lymphocytes. It undergoes tyrosine phosphorylation and associates with the Src homology 2 domain-containing protein (SH2D1A) as well as with SH2 domain-containing phosphatases (SHPs). It functions as a coreceptor in the process of NK cell activation. It can also mediate inhibitory signals in NK cells from X-linked lymphoproliferative patients. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for one null allele show no overt phenotype. Mice homozygous for another null allele show impaired IL-4 production by CD4+ T cells, reduced inflammatory response to L. mexicana infection, high susceptibility to S. typhimurium infection, and defective neutrophil bactericidal activity. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock

Total: 104 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb1b	T	G	5: 8,821,322	I292S	possibly damaging	Het
Abcc4	T	C	14: 118,526,282	N1047S	probably benign	Het
Abcc8	G	T	7: 46,117,423		probably null	Het
Akap9	T	A	5: 4,038,520		probably null	Het
Alox5	T	A	6: 116,415,463	I366F	probably damaging	Het
Amn	A	G	12: 111,276,092	N447S	probably damaging	Het
Ankrd22	A	T	19: 34,165,774	M1K	probably null	Het
Asic1	G	T	15: 99,671,884	G29C	probably damaging	Het
Atxn7l1	A	G	12: 33,345,977	N235S	probably benign	Het
AY358078	T	A	14: 51,826,062	D388E	probably damaging	Het
Bod1l	A	G	5: 41,817,336	S2212P	probably damaging	Het
Cacna1e	T	A	1: 154,477,817	Q423L	probably damaging	Het
Calu	T	C	6: 29,366,975	I62T	possibly damaging	Het
Cars2	A	G	8: 11,514,515	V75A	probably benign	Het
Catsperb	T	A	12: 101,602,767	N899K	possibly damaging	Het
Ccdc50	T	A	16: 27,409,339	C86*	probably null	Het
Cdh5	G	T	8: 104,137,815	L469F	probably damaging	Het
Clrn3	A	T	7: 135,514,119	D167E	probably benign	Het
Csmd1	A	T	8: 16,346,684	C411S	probably damaging	Het
Dchs1	A	T	7: 105,762,548	S1454T	probably benign	Het
Ddx20	G	A	3: 105,679,344	Q562*	probably null	Het
Dgkg	T	G	16: 22,600,594	Y52S	probably damaging	Het
Dhx58	T	C	11: 100,703,490		probably null	Het
Dpp6	A	T	5: 27,399,006	I145L	probably benign	Het
Efna2	A	T	10: 80,186,877	Y85F	possibly damaging	Het
Eif3a	C	T	19: 60,781,516	V127I	probably benign	Het
Exph5	A	T	9: 53,373,635	H672L	possibly damaging	Het
Fam131b	T	C	6: 42,320,884	T112A	possibly damaging	Het
Fam71e2	A	T	7: 4,758,018	V565E	probably damaging	Het
Fcgr1	A	T	3: 96,285,868	V271E	probably damaging	Het
Fgfr4	A	G	13: 55,165,902	D508G	probably damaging	Het
Fndc3b	A	G	3: 27,419,400	M1172T	probably benign	Het
Fryl	G	T	5: 73,108,493	T495K	probably damaging	Het
Gm5134	A	T	10: 75,966,393	I93F	probably damaging	Het
Gpbar1	G	A	1: 74,279,444	G282D	possibly damaging	Het
Gria2	G	A	3: 80,802,357	L10F	probably benign	Het
Grm7	T	C	6: 111,207,808	Y367H	probably benign	Het
Hils1	T	A	11: 94,968,032	V51E	probably damaging	Het
Hivep1	G	A	13: 42,157,493	A1070T	probably benign	Het
Il33	A	G	19: 29,956,904	D155G	possibly damaging	Het
Kdm6b	T	C	11: 69,406,303	S408G	probably null	Het
Kntc1	G	A	5: 123,759,099		probably null	Het
Kntc1	A	G	5: 123,810,811		probably null	Het
Ltbp2	T	G	12: 84,808,446		probably null	Het
Mapk8ip3	G	T	17: 24,914,588	L83I	probably damaging	Het
Meltf	C	A	16: 31,892,622	Y554*	probably null	Het
Mov10	A	C	3: 104,799,419	F725C	probably damaging	Het
Ms4a6d	A	C	19: 11,590,159	L18R	probably damaging	Het
Naip2	T	C	13: 100,162,007	N507S	probably benign	Het
Nodal	A	G	10: 61,418,334	Q12R	probably benign	Het
Npy6r	T	C	18: 44,276,508	L332P	probably damaging	Het
Nrxn3	A	G	12: 89,260,411	K272R	possibly damaging	Het
Obox2	G	T	7: 15,397,249	K93N	probably benign	Het
Olfr1136	C	T	2: 87,693,433	V150M	probably benign	Het
Olfr1408	C	T	1: 173,130,851	R122H	possibly damaging	Het
Olfr1466	A	G	19: 13,341,814	T19A	possibly damaging	Het
Olfr575	G	T	7: 102,954,746	P285Q	probably damaging	Het
Pcdh12	T	A	18: 38,282,143	D643V	possibly damaging	Het
Pcsk2	A	G	2: 143,687,619	D112G	probably benign	Het
Pms1	A	G	1: 53,195,015	S781P	probably benign	Het
Prtg	A	G	9: 72,844,896	D188G	probably benign	Het
Psg21	A	T	7: 18,654,770	N132K	probably benign	Het
Psip1	A	G	4: 83,482,532	V25A	probably damaging	Het
Psmd13	T	A	7: 140,898,194	I319N	probably damaging	Het
Ptges2	A	G	2: 32,400,092	T173A	probably benign	Het
Ptprm	G	A	17: 66,747,160	R975W	probably damaging	Het
Rdh1	A	G	10: 127,765,345	D254G	probably benign	Het
Rnf138	T	G	18: 21,024,483	N212K	probably damaging	Het
Serpine2	A	G	1: 79,821,442	S32P	probably damaging	Het
Serpini1	G	T	3: 75,614,664	W154L	probably damaging	Het
Sf3a1	C	A	11: 4,179,177	Q713K	possibly damaging	Het
Sgo2b	A	T	8: 63,926,833	H988Q	probably benign	Het
Sin3a	T	C	9: 57,101,199	F468L	probably damaging	Het
Slc22a28	A	T	19: 8,117,124	C178S	possibly damaging	Het
Slc35a1	A	C	4: 34,675,181	V119G	probably damaging	Het
Slc39a12	A	T	2: 14,434,219	H428L	probably damaging	Het
Speer2	A	G	16: 69,858,077	S167P	probably benign	Het
Sphkap	G	A	1: 83,277,515	R838*	probably null	Het
Spsb2	T	C	6: 124,809,366		probably null	Het
Stam2	A	T	2: 52,703,156	Y341*	probably null	Het
Sv2b	G	A	7: 75,206,341	A67V	probably benign	Het
Svep1	A	G	4: 58,064,170		probably null	Het
Syt15	A	T	14: 34,223,012	Q172L	probably benign	Het
T	G	A	17: 8,441,802	S415N	probably benign	Het
Tep1	A	G	14: 50,824,184	F2625S	possibly damaging	Het
Tex14	T	C	11: 87,536,755	V11A	possibly damaging	Het
Tiam2	A	T	17: 3,415,126	R377*	probably null	Het
Tirap	A	G	9: 35,191,016		probably null	Het
Tm4sf20	T	C	1: 82,760,217	T118A	probably benign	Het
Trank1	A	T	9: 111,378,832	Q1715L	probably benign	Het
Trpm2	C	T	10: 77,947,989	V217M	probably damaging	Het
Ubap1l	G	A	9: 65,371,796	E126K	possibly damaging	Het
Urgcp	G	T	11: 5,716,526	P604Q	probably damaging	Het
Vmn1r63	A	G	7: 5,803,255	V126A	probably benign	Het
Vmn2r90	T	C	17: 17,713,263	C362R	probably damaging	Het
Vmn2r96	A	G	17: 18,583,876	I271V	probably damaging	Het
Vps13a	A	T	19: 16,722,458	I740K	probably benign	Het
Vps13c	A	G	9: 67,975,856	T3562A	probably damaging	Het
Wdr91	T	A	6: 34,892,362	H409L	probably damaging	Het
Wnt7a	T	A	6: 91,365,956	T315S	possibly damaging	Het
Zfp616	A	G	11: 74,084,969	H688R	probably benign	Het
Zfp763	A	T	17: 33,018,439	H577Q	probably damaging	Het
Zfp808	G	A	13: 62,172,907	S650N	probably benign	Het
Zfp977	A	T	7: 42,579,985	M372K	probably benign	Het

Other mutations in Slamf6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00964:Slamf6	APN	1	171917780	missense	probably null	0.27
IGL01011:Slamf6	APN	1	171938099	missense	probably benign	0.19
P0016:Slamf6	UTSW	1	171936501	missense	probably damaging	0.97
R1565:Slamf6	UTSW	1	171934408	missense	possibly damaging	0.53
R1763:Slamf6	UTSW	1	171942587	intron	probably benign
R1774:Slamf6	UTSW	1	171942587	intron	probably benign
R2155:Slamf6	UTSW	1	171938008	missense	probably damaging	0.99
R2328:Slamf6	UTSW	1	171934251	missense	probably benign	0.00
R4693:Slamf6	UTSW	1	171934113	nonsense	probably null
R5062:Slamf6	UTSW	1	171936533	missense	possibly damaging	0.93
R5172:Slamf6	UTSW	1	171936580	missense	probably benign	0.01
R5249:Slamf6	UTSW	1	171936682	missense	probably damaging	1.00
R5328:Slamf6	UTSW	1	171938095	missense	probably benign	0.04
R5771:Slamf6	UTSW	1	171917774	missense	probably damaging	0.98
R6339:Slamf6	UTSW	1	171948048	missense	probably null	1.00
R6960:Slamf6	UTSW	1	171917753	missense	probably damaging	0.98
R7176:Slamf6	UTSW	1	171934291	missense	probably benign	0.13
R7400:Slamf6	UTSW	1	171919793	missense	unknown
R7535:Slamf6	UTSW	1	171919758	missense	unknown
R7629:Slamf6	UTSW	1	171936624	missense	probably damaging	0.97
R8202:Slamf6	UTSW	1	171934219	missense	probably benign	0.01
R8934:Slamf6	UTSW	1	171917771	missense	possibly damaging	0.76
R9225:Slamf6	UTSW	1	171936703	missense	probably benign	0.25
R9338:Slamf6	UTSW	1	171919590	intron	probably benign
RF025:Slamf6	UTSW	1	171941582	critical splice acceptor site	probably benign

Predicted Primers

PCR Primer
(F):5'- TCTGGCCTTCTTCCAAAGAGC -3'
(R):5'- CTGCGCAGTGTATGATCCTGTG -3'

Sequencing Primer
(F):5'- TGGCCTTCTTCCAAAGAGCTTAAAC -3'
(R):5'- ATCCTGTGTCTGCCATGGTAAG -3'

Posted On

2014-08-25