Incidental Mutation 'R1993:Olfr1408'
ID223813
Institutional Source Beutler Lab
Gene Symbol Olfr1408
Ensembl Gene ENSMUSG00000062527
Gene Nameolfactory receptor 1408
SynonymsMOR267-4, GA_x6K02T2R7CC-715776-716708
MMRRC Submission 040004-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R1993 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location173128049-173137374 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 173130851 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 122 (R122H)
Ref Sequence ENSEMBL: ENSMUSP00000073345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073663] [ENSMUST00000200689]
Predicted Effect possibly damaging
Transcript: ENSMUST00000073663
AA Change: R122H

PolyPhen 2 Score 0.646 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000073345
Gene: ENSMUSG00000062527
AA Change: R122H

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.5e-55 PFAM
Pfam:7tm_1 41 289 9.4e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200689
AA Change: R122H

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000143864
Gene: ENSMUSG00000062527
AA Change: R122H

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.5e-55 PFAM
Pfam:7tm_1 41 289 9.4e-19 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T G 5: 8,821,322 I292S possibly damaging Het
Abcc4 T C 14: 118,526,282 N1047S probably benign Het
Abcc8 G T 7: 46,117,423 probably null Het
Akap9 T A 5: 4,038,520 probably null Het
Alox5 T A 6: 116,415,463 I366F probably damaging Het
Amn A G 12: 111,276,092 N447S probably damaging Het
Ankrd22 A T 19: 34,165,774 M1K probably null Het
Asic1 G T 15: 99,671,884 G29C probably damaging Het
Atxn7l1 A G 12: 33,345,977 N235S probably benign Het
AY358078 T A 14: 51,826,062 D388E probably damaging Het
Bod1l A G 5: 41,817,336 S2212P probably damaging Het
Cacna1e T A 1: 154,477,817 Q423L probably damaging Het
Calu T C 6: 29,366,975 I62T possibly damaging Het
Cars2 A G 8: 11,514,515 V75A probably benign Het
Catsperb T A 12: 101,602,767 N899K possibly damaging Het
Ccdc50 T A 16: 27,409,339 C86* probably null Het
Cdh5 G T 8: 104,137,815 L469F probably damaging Het
Clrn3 A T 7: 135,514,119 D167E probably benign Het
Csmd1 A T 8: 16,346,684 C411S probably damaging Het
Dchs1 A T 7: 105,762,548 S1454T probably benign Het
Ddx20 G A 3: 105,679,344 Q562* probably null Het
Dgkg T G 16: 22,600,594 Y52S probably damaging Het
Dhx58 T C 11: 100,703,490 probably null Het
Dpp6 A T 5: 27,399,006 I145L probably benign Het
Efna2 A T 10: 80,186,877 Y85F possibly damaging Het
Eif3a C T 19: 60,781,516 V127I probably benign Het
Exph5 A T 9: 53,373,635 H672L possibly damaging Het
Fam131b T C 6: 42,320,884 T112A possibly damaging Het
Fam71e2 A T 7: 4,758,018 V565E probably damaging Het
Fcgr1 A T 3: 96,285,868 V271E probably damaging Het
Fgfr4 A G 13: 55,165,902 D508G probably damaging Het
Fndc3b A G 3: 27,419,400 M1172T probably benign Het
Fryl G T 5: 73,108,493 T495K probably damaging Het
Gm5134 A T 10: 75,966,393 I93F probably damaging Het
Gpbar1 G A 1: 74,279,444 G282D possibly damaging Het
Gria2 G A 3: 80,802,357 L10F probably benign Het
Grm7 T C 6: 111,207,808 Y367H probably benign Het
Hils1 T A 11: 94,968,032 V51E probably damaging Het
Hivep1 G A 13: 42,157,493 A1070T probably benign Het
Il33 A G 19: 29,956,904 D155G possibly damaging Het
Kdm6b T C 11: 69,406,303 S408G probably null Het
Kntc1 G A 5: 123,759,099 probably null Het
Kntc1 A G 5: 123,810,811 probably null Het
Ltbp2 T G 12: 84,808,446 probably null Het
Mapk8ip3 G T 17: 24,914,588 L83I probably damaging Het
Meltf C A 16: 31,892,622 Y554* probably null Het
Mov10 A C 3: 104,799,419 F725C probably damaging Het
Ms4a6d A C 19: 11,590,159 L18R probably damaging Het
Naip2 T C 13: 100,162,007 N507S probably benign Het
Nodal A G 10: 61,418,334 Q12R probably benign Het
Npy6r T C 18: 44,276,508 L332P probably damaging Het
Nrxn3 A G 12: 89,260,411 K272R possibly damaging Het
Obox2 G T 7: 15,397,249 K93N probably benign Het
Olfr1136 C T 2: 87,693,433 V150M probably benign Het
Olfr1466 A G 19: 13,341,814 T19A possibly damaging Het
Olfr575 G T 7: 102,954,746 P285Q probably damaging Het
Pcdh12 T A 18: 38,282,143 D643V possibly damaging Het
Pcsk2 A G 2: 143,687,619 D112G probably benign Het
Pms1 A G 1: 53,195,015 S781P probably benign Het
Prtg A G 9: 72,844,896 D188G probably benign Het
Psg21 A T 7: 18,654,770 N132K probably benign Het
Psip1 A G 4: 83,482,532 V25A probably damaging Het
Psmd13 T A 7: 140,898,194 I319N probably damaging Het
Ptges2 A G 2: 32,400,092 T173A probably benign Het
Ptprm G A 17: 66,747,160 R975W probably damaging Het
Rdh1 A G 10: 127,765,345 D254G probably benign Het
Rnf138 T G 18: 21,024,483 N212K probably damaging Het
Serpine2 A G 1: 79,821,442 S32P probably damaging Het
Serpini1 G T 3: 75,614,664 W154L probably damaging Het
Sf3a1 C A 11: 4,179,177 Q713K possibly damaging Het
Sgo2b A T 8: 63,926,833 H988Q probably benign Het
Sin3a T C 9: 57,101,199 F468L probably damaging Het
Slamf6 A T 1: 171,934,209 I66F possibly damaging Het
Slc22a28 A T 19: 8,117,124 C178S possibly damaging Het
Slc35a1 A C 4: 34,675,181 V119G probably damaging Het
Slc39a12 A T 2: 14,434,219 H428L probably damaging Het
Speer2 A G 16: 69,858,077 S167P probably benign Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Spsb2 T C 6: 124,809,366 probably null Het
Stam2 A T 2: 52,703,156 Y341* probably null Het
Sv2b G A 7: 75,206,341 A67V probably benign Het
Svep1 A G 4: 58,064,170 probably null Het
Syt15 A T 14: 34,223,012 Q172L probably benign Het
T G A 17: 8,441,802 S415N probably benign Het
Tep1 A G 14: 50,824,184 F2625S possibly damaging Het
Tex14 T C 11: 87,536,755 V11A possibly damaging Het
Tiam2 A T 17: 3,415,126 R377* probably null Het
Tirap A G 9: 35,191,016 probably null Het
Tm4sf20 T C 1: 82,760,217 T118A probably benign Het
Trank1 A T 9: 111,378,832 Q1715L probably benign Het
Trpm2 C T 10: 77,947,989 V217M probably damaging Het
Ubap1l G A 9: 65,371,796 E126K possibly damaging Het
Urgcp G T 11: 5,716,526 P604Q probably damaging Het
Vmn1r63 A G 7: 5,803,255 V126A probably benign Het
Vmn2r90 T C 17: 17,713,263 C362R probably damaging Het
Vmn2r96 A G 17: 18,583,876 I271V probably damaging Het
Vps13a A T 19: 16,722,458 I740K probably benign Het
Vps13c A G 9: 67,975,856 T3562A probably damaging Het
Wdr91 T A 6: 34,892,362 H409L probably damaging Het
Wnt7a T A 6: 91,365,956 T315S possibly damaging Het
Zfp616 A G 11: 74,084,969 H688R probably benign Het
Zfp763 A T 17: 33,018,439 H577Q probably damaging Het
Zfp808 G A 13: 62,172,907 S650N probably benign Het
Zfp977 A T 7: 42,579,985 M372K probably benign Het
Other mutations in Olfr1408
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Olfr1408 APN 1 173130411 nonsense probably null
IGL01371:Olfr1408 APN 1 173130531 missense possibly damaging 0.67
IGL01816:Olfr1408 APN 1 173130273 utr 3 prime probably benign
IGL02543:Olfr1408 APN 1 173130334 missense probably damaging 0.99
IGL03104:Olfr1408 APN 1 173130959 missense probably benign 0.00
IGL03183:Olfr1408 APN 1 173130858 missense probably damaging 0.97
R0940:Olfr1408 UTSW 1 173130453 missense probably benign 0.42
R1835:Olfr1408 UTSW 1 173130815 missense probably benign 0.00
R1994:Olfr1408 UTSW 1 173130851 missense possibly damaging 0.65
R4438:Olfr1408 UTSW 1 173130302 missense probably benign 0.02
R4948:Olfr1408 UTSW 1 173130959 missense probably benign 0.00
R5088:Olfr1408 UTSW 1 173131039 missense probably damaging 1.00
R5117:Olfr1408 UTSW 1 173130917 missense possibly damaging 0.91
R5118:Olfr1408 UTSW 1 173130917 missense possibly damaging 0.91
R5344:Olfr1408 UTSW 1 173131106 missense probably benign 0.16
X0018:Olfr1408 UTSW 1 173130699 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCCAAAATAGGACGGACATCGC -3'
(R):5'- TTATCCGCATTGACCACCAC -3'

Sequencing Primer
(F):5'- CGCAGAAGAAATGTTTAATCAGTGTG -3'
(R):5'- ACACCCCCATGTATTTCTTCCTAAG -3'
Posted On2014-08-25