Mutagenetix > Incidental Mutation

Incidental Mutation 'R2020:Gtf2ird1'

223814

Institutional Source

Beutler Lab

Gene Symbol

Gtf2ird1

Ensembl Gene

ENSMUSG00000023079

Gene Name

general transcription factor II I repeat domain-containing 1

Synonyms

binding factor for early enhancer, MusTRD1, GTF3, WBSCR11, Tg(Alb1-Myc)166.8Sst, ESTM9, c-myc line 166.8, Alb/c-myc line 166.8, Alb-c-myc line 166.8, Cream1, BEN

MMRRC Submission

040029-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.751) question?

Stock #

R2020 (G1)

Quality Score

163

Status

Validated

Chromosome

Chromosomal Location

134357656-134456716 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 134417093 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 28 (D28G)

Ref Sequence

ENSEMBL: ENSMUSP00000143809 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000073161] [ENSMUST00000074114] [ENSMUST00000100650] [ENSMUST00000100652] [ENSMUST00000100654] [ENSMUST00000111244] [ENSMUST00000111245] [ENSMUST00000167084] [ENSMUST00000171794] [ENSMUST00000201647] [ENSMUST00000202280] [ENSMUST00000202554] [ENSMUST00000200944]

AlphaFold

Q9JI57

Predicted Effect

probably damaging
Transcript: ENSMUST00000073161
AA Change: D28G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000072904
Gene: ENSMUSG00000023079
AA Change: D28G

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	203	1.5e-29	PFAM
Pfam:GTF2I	351	426	4.9e-33	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	640	1.1e-34	PFAM
Pfam:GTF2I	690	765	3.1e-34	PFAM
Pfam:GTF2I	814	889	1.7e-34	PFAM
Pfam:GTF2I	917	992	1.7e-34	PFAM
low complexity region	1020	1043	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000074114
AA Change: D28G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000073752
Gene: ENSMUSG00000023079
AA Change: D28G

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	203	1.4e-29	PFAM
Pfam:GTF2I	351	426	4.5e-33	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	640	1.1e-34	PFAM
Pfam:GTF2I	690	765	2.8e-34	PFAM
Pfam:GTF2I	814	889	1.6e-34	PFAM
low complexity region	917	940	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000100650
AA Change: D28G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000098215
Gene: ENSMUSG00000023079
AA Change: D28G

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	203	1.5e-29	PFAM
Pfam:GTF2I	351	426	4.9e-33	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	640	1.2e-34	PFAM
Pfam:GTF2I	690	765	3.1e-34	PFAM
Pfam:GTF2I	787	862	1.8e-34	PFAM
Pfam:GTF2I	890	965	1.8e-34	PFAM
low complexity region	993	1016	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000100652
AA Change: D28G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000098217
Gene: ENSMUSG00000023079
AA Change: D28G

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	202	5.8e-29	PFAM
Pfam:GTF2I	351	425	6.6e-32	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	639	2.3e-34	PFAM
Pfam:GTF2I	690	764	3.3e-32	PFAM
Pfam:GTF2I	814	888	3e-33	PFAM
Pfam:GTF2I	917	991	3e-33	PFAM
low complexity region	1020	1043	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000100654
AA Change: D28G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000098219
Gene: ENSMUSG00000023079
AA Change: D28G

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	203	1.3e-29	PFAM
Pfam:GTF2I	351	426	4.3e-33	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	640	1e-34	PFAM
Pfam:GTF2I	716	791	1.5e-34	PFAM
Pfam:GTF2I	819	894	1.5e-34	PFAM
low complexity region	922	945	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000104249

Predicted Effect

probably damaging
Transcript: ENSMUST00000111244
AA Change: D28G

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000106875
Gene: ENSMUSG00000023079
AA Change: D28G

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	202	4.3e-29	PFAM
Pfam:GTF2I	351	425	4.9e-32	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	639	1.7e-34	PFAM
Pfam:GTF2I	690	764	2.5e-32	PFAM
Pfam:GTF2I	787	861	2.3e-33	PFAM
Pfam:GTF2I	890	964	2.3e-33	PFAM
low complexity region	993	1016	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000111245
AA Change: D28G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000106876
Gene: ENSMUSG00000023079
AA Change: D28G

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	203	1.4e-29	PFAM
Pfam:GTF2I	351	426	4.6e-33	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	640	1.1e-34	PFAM
Pfam:GTF2I	671	746	2.9e-34	PFAM
Pfam:GTF2I	768	843	1.7e-34	PFAM
Pfam:GTF2I	871	946	1.7e-34	PFAM
low complexity region	974	997	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000167084
AA Change: D28G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000132882
Gene: ENSMUSG00000023079
AA Change: D28G

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	203	1.3e-29	PFAM
Pfam:GTF2I	351	426	4.3e-33	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	640	1e-34	PFAM
Pfam:GTF2I	690	765	2.7e-34	PFAM
Pfam:GTF2I	814	889	1.5e-34	PFAM
low complexity region	917	940	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000171794
AA Change: D28G

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000129392
Gene: ENSMUSG00000023079
AA Change: D28G

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	203	1.2e-29	PFAM
Pfam:GTF2I	351	426	3.8e-33	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	640	8.9e-35	PFAM
Pfam:GTF2I	690	765	2.4e-34	PFAM
Pfam:GTF2I	787	862	1.4e-34	PFAM
Pfam:GTF2I	890	965	1.4e-34	PFAM
low complexity region	993	1016	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000201647
AA Change: D28G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

Predicted Effect

probably damaging
Transcript: ENSMUST00000202280
AA Change: D28G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000143897
Gene: ENSMUSG00000023079
AA Change: D28G

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	202	2.6e-26	PFAM
Pfam:GTF2I	351	425	2.9e-29	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	639	1e-31	PFAM
Pfam:GTF2I	690	764	1.5e-29	PFAM
Pfam:GTF2I	787	861	1.3e-30	PFAM
low complexity region	890	913	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000202554
AA Change: D28G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000143809
Gene: ENSMUSG00000023079
AA Change: D28G

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	202	5.5e-29	PFAM
Pfam:GTF2I	351	425	6.3e-32	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	639	2.2e-34	PFAM
Pfam:GTF2I	671	745	3.2e-32	PFAM
Pfam:GTF2I	768	842	2.9e-33	PFAM
Pfam:GTF2I	871	945	2.9e-33	PFAM
low complexity region	974	997	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000200944
AA Change: D28G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000143848
Gene: ENSMUSG00000023079
AA Change: D28G

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	202	4.9e-29	PFAM
Pfam:GTF2I	351	425	5.6e-32	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	639	2e-34	PFAM
Pfam:GTF2I	690	764	2.8e-32	PFAM
Pfam:GTF2I	814	888	2.6e-33	PFAM
low complexity region	917	940	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202414

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202763

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202335

Predicted Effect

probably benign
Transcript: ENSMUST00000201704

Meta Mutation Damage Score

0.0654

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 93.6%

Validation Efficiency

99% (87/88)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains five GTF2I-like repeats and each repeat possesses a potential helix-loop-helix (HLH) motif. It may have the ability to interact with other HLH-proteins and function as a transcription factor or as a positive transcriptional regulator under the control of Retinoblastoma protein. This gene plays a role in craniofacial and cognitive development and mutations have been associated with Williams-Beuren syndrome, a multisystem developmental disorder caused by deletion of multiple genes at 7q11.23. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygotes for one null allele is embryonic lethal with abnormal yolk sac vasulogenesis, abnormal angiogenesis, and neural tube defect. Other null allele homozygous mice are viable and have behavioral defects and exhibit a mild craniofacial defect withvariable penetrance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600012P17Rik	C	A	1: 158,968,912		noncoding transcript	Het
9530053A07Rik	T	C	7: 28,155,594	S1882P	probably benign	Het
Adam17	G	A	12: 21,349,875	R177C	probably damaging	Het
Ak7	G	A	12: 105,745,332		probably null	Het
Akap9	T	C	5: 3,961,967	V890A	probably damaging	Het
Alg6	A	G	4: 99,738,132	N59S	probably damaging	Het
Alkbh5	G	T	11: 60,538,549	A43S	probably benign	Het
Anxa2	C	A	9: 69,483,817	D162E	probably damaging	Het
Arap1	A	G	7: 101,401,518	H1136R	probably benign	Het
Arhgap18	A	G	10: 26,854,904	R121G	probably benign	Het
Arhgef4	A	T	1: 34,723,810	T716S	unknown	Het
Atg2a	T	C	19: 6,250,269		probably null	Het
Ccdc27	T	C	4: 154,033,313	I480V	probably null	Het
Cdipt	T	C	7: 126,976,933	V20A	possibly damaging	Het
Cgrrf1	C	T	14: 46,830,445		probably benign	Het
Chd7	G	A	4: 8,855,226	V2152I	probably benign	Het
Chd8	T	A	14: 52,215,241	S1274C	probably damaging	Het
Chuk	A	T	19: 44,107,343	M17K	possibly damaging	Het
Col14a1	C	T	15: 55,446,181		probably benign	Het
Col20a1	G	A	2: 181,013,163		probably null	Het
Cped1	A	G	6: 22,143,964	I570V	probably benign	Het
Cul9	C	G	17: 46,522,175	A1326P	probably damaging	Het
Ddx27	A	C	2: 167,033,771	Q674P	probably damaging	Het
Dennd6a	T	A	14: 26,612,003	F131L	probably damaging	Het
Dhx38	G	A	8: 109,556,869		probably benign	Het
Dido1	G	T	2: 180,659,585	N2175K	unknown	Het
Dmxl1	T	A	18: 49,889,558	Y1654*	probably null	Het
Dock7	T	A	4: 98,959,101	H1658L	probably damaging	Het
Dync2h1	T	A	9: 7,122,772	E2061D	probably damaging	Het
Dync2h1	T	C	9: 7,162,925	I555V	probably benign	Het
Eif2ak2	T	C	17: 78,863,963	E337G	possibly damaging	Het
Fabp12	T	A	3: 10,250,149	D46V	probably benign	Het
Fech	C	T	18: 64,478,727	E79K	probably damaging	Het
Flnc	A	T	6: 29,444,363	I693F	probably damaging	Het
Foxp2	G	A	6: 15,324,644	C97Y	possibly damaging	Het
Grin2b	A	G	6: 135,733,896	M884T	probably benign	Het
Gtf3c4	C	A	2: 28,833,894	G468W	possibly damaging	Het
Ift172	A	T	5: 31,267,241	L201*	probably null	Het
Il1rl2	C	A	1: 40,365,214	S498R	probably damaging	Het
Ildr1	C	T	16: 36,725,541	R489W	probably damaging	Het
Itga10	G	A	3: 96,652,490	G487D	probably damaging	Het
Klk8	A	G	7: 43,799,216	N128D	probably benign	Het
Lgr6	G	A	1: 135,075,275	T79M	probably damaging	Het
Med6	T	C	12: 81,573,877	T232A	probably benign	Het
Mgat4e	A	G	1: 134,541,322	L328P	probably damaging	Het
Mttp	A	G	3: 138,118,402	Y138H	probably damaging	Het
Ngef	T	C	1: 87,545,968	R31G	probably benign	Het
Nipsnap2	C	A	5: 129,753,223		probably null	Het
Nlgn2	G	T	11: 69,828,441	N194K	probably damaging	Het
Olfr1026	A	G	2: 85,923,743	I158M	probably benign	Het
Olfr1245	A	T	2: 89,574,961	M255K	possibly damaging	Het
Olfr1450	G	A	19: 12,954,332	V248I	possibly damaging	Het
Olfr357	G	A	2: 36,997,652	V281M	possibly damaging	Het
Olfr894	A	G	9: 38,219,432	Y203C	possibly damaging	Het
Pcca	T	A	14: 122,813,222	M101K	possibly damaging	Het
Plekha6	A	G	1: 133,284,970	T671A	possibly damaging	Het
Prex2	G	A	1: 11,162,312	V868M	probably damaging	Het
Prkcq	G	A	2: 11,279,521	V501I	probably benign	Het
Prom1	T	A	5: 44,011,253		probably benign	Het
Ptprd	A	G	4: 76,133,161	V41A	probably damaging	Het
Rab39	C	T	9: 53,686,398	G189E	possibly damaging	Het
Ret	T	C	6: 118,180,382	K236E	possibly damaging	Het
Rfx6	G	A	10: 51,720,057		probably null	Het
Rnf213	A	G	11: 119,461,918	T3916A	probably damaging	Het
Rpn1	A	G	6: 88,095,683	N336S	probably damaging	Het
Sag	G	A	1: 87,805,315	A2T	probably damaging	Het
Sco2	T	C	15: 89,371,860	Y197C	probably damaging	Het
Sec23b	T	C	2: 144,566,944	I183T	possibly damaging	Het
Sec24b	C	T	3: 129,987,728	V1166M	probably damaging	Het
Slc27a5	A	T	7: 12,993,412	F361Y	probably damaging	Het
Spaca9	A	G	2: 28,696,001	L17P	probably damaging	Het
Sqor	T	C	2: 122,804,107		probably null	Het
Stx18	A	G	5: 38,135,244	H230R	probably damaging	Het
Tas2r130	A	T	6: 131,630,769	I21N	probably damaging	Het
Tcaf3	A	G	6: 42,593,724	S365P	possibly damaging	Het
Tinagl1	G	A	4: 130,166,972	H351Y	probably damaging	Het
Tmc2	T	C	2: 130,232,385	Y333H	probably damaging	Het
Trp53bp2	A	T	1: 182,442,819	T395S	probably damaging	Het
Tsc22d1	T	C	14: 76,418,333	S751P	probably damaging	Het
Ttc30a1	A	G	2: 75,980,935	V268A	probably benign	Het
Ttn	A	G	2: 76,827,024		probably benign	Het
Ugdh	T	C	5: 65,416,925	Y425C	probably damaging	Het
Vmn1r115	G	A	7: 20,844,169	L273F	probably null	Het
Vmn2r109	A	T	17: 20,541,186	C636*	probably null	Het
Vmn2r59	A	C	7: 42,043,779	Y466D	probably damaging	Het
Zic5	C	T	14: 122,464,830	G163D	unknown	Het

Other mutations in Gtf2ird1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00558:Gtf2ird1	APN	5	134358891	missense	probably benign	0.03
IGL02477:Gtf2ird1	APN	5	134379978	missense	probably damaging	1.00
IGL02659:Gtf2ird1	APN	5	134377041	missense	probably damaging	1.00
IGL02752:Gtf2ird1	APN	5	134358824	makesense	probably null
IGL02963:Gtf2ird1	APN	5	134389687	missense	probably benign	0.05
IGL03328:Gtf2ird1	APN	5	134389129	critical splice donor site	probably null
IGL03379:Gtf2ird1	APN	5	134382538	missense	possibly damaging	0.94
R0585:Gtf2ird1	UTSW	5	134376942	missense	probably damaging	1.00
R1199:Gtf2ird1	UTSW	5	134411064	missense	possibly damaging	0.85
R1388:Gtf2ird1	UTSW	5	134395710	missense	probably damaging	1.00
R1470:Gtf2ird1	UTSW	5	134395802	critical splice acceptor site	probably null
R1470:Gtf2ird1	UTSW	5	134395802	critical splice acceptor site	probably null
R1544:Gtf2ird1	UTSW	5	134358918	missense	possibly damaging	0.93
R1652:Gtf2ird1	UTSW	5	134395713	missense	probably damaging	1.00
R1792:Gtf2ird1	UTSW	5	134366936	splice site	probably null
R1852:Gtf2ird1	UTSW	5	134382580	splice site	probably null
R1938:Gtf2ird1	UTSW	5	134415245	missense	probably damaging	1.00
R1996:Gtf2ird1	UTSW	5	134376886	splice site	probably benign
R2025:Gtf2ird1	UTSW	5	134363934	missense	probably damaging	1.00
R2849:Gtf2ird1	UTSW	5	134359007	missense	probably damaging	1.00
R2964:Gtf2ird1	UTSW	5	134357684	splice site	probably null
R3421:Gtf2ird1	UTSW	5	134388500	missense	probably benign	0.41
R4543:Gtf2ird1	UTSW	5	134363900	critical splice donor site	probably null
R4569:Gtf2ird1	UTSW	5	134411003	missense	probably damaging	1.00
R4664:Gtf2ird1	UTSW	5	134383902	missense	probably damaging	1.00
R4665:Gtf2ird1	UTSW	5	134383902	missense	probably damaging	1.00
R4666:Gtf2ird1	UTSW	5	134383902	missense	probably damaging	1.00
R4680:Gtf2ird1	UTSW	5	134357881	missense	probably damaging	1.00
R4709:Gtf2ird1	UTSW	5	134404734	missense	probably benign
R4806:Gtf2ird1	UTSW	5	134383896	missense	probably damaging	0.99
R4823:Gtf2ird1	UTSW	5	134395722	missense	probably damaging	1.00
R4857:Gtf2ird1	UTSW	5	134362544	missense	probably damaging	0.96
R4970:Gtf2ird1	UTSW	5	134402184	missense	probably damaging	1.00
R4974:Gtf2ird1	UTSW	5	134357831	nonsense	probably null
R4975:Gtf2ird1	UTSW	5	134395627	missense	probably damaging	1.00
R5072:Gtf2ird1	UTSW	5	134390933	splice site	probably null
R5112:Gtf2ird1	UTSW	5	134402184	missense	probably damaging	1.00
R5653:Gtf2ird1	UTSW	5	134410967	missense	probably damaging	1.00
R5681:Gtf2ird1	UTSW	5	134363318	missense	probably damaging	1.00
R5738:Gtf2ird1	UTSW	5	134383818	missense	probably damaging	1.00
R5753:Gtf2ird1	UTSW	5	134410983	missense	probably damaging	1.00
R6385:Gtf2ird1	UTSW	5	134404690	missense	probably benign	0.19
R6580:Gtf2ird1	UTSW	5	134361039	missense	probably damaging	1.00
R6787:Gtf2ird1	UTSW	5	134363912	missense	probably damaging	0.99
R6981:Gtf2ird1	UTSW	5	134383922	splice site	probably benign
R7208:Gtf2ird1	UTSW	5	134411094	missense	probably benign	0.35
R7271:Gtf2ird1	UTSW	5	134404904	missense	probably benign	0.01
R7517:Gtf2ird1	UTSW	5	134362525	missense	probably benign
R7786:Gtf2ird1	UTSW	5	134390899	nonsense	probably null
R7788:Gtf2ird1	UTSW	5	134417131	nonsense	probably null
R7850:Gtf2ird1	UTSW	5	134363215	missense	probably benign	0.21
R7866:Gtf2ird1	UTSW	5	134363209	missense	probably benign	0.01
R8183:Gtf2ird1	UTSW	5	134357835	missense	unknown
R8712:Gtf2ird1	UTSW	5	134415210	missense	probably damaging	1.00
R8844:Gtf2ird1	UTSW	5	134361025	nonsense	probably null
R9473:Gtf2ird1	UTSW	5	134404680	missense	probably benign	0.08
R9669:Gtf2ird1	UTSW	5	134379940	missense	probably damaging	0.99
R9737:Gtf2ird1	UTSW	5	134379940	missense	probably damaging	0.99
X0026:Gtf2ird1	UTSW	5	134376102	splice site	probably null
Z1176:Gtf2ird1	UTSW	5	134409312	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- CTGGTCTTGAGCCATGCATG -3'
(R):5'- GTCCCACTTGTGAATTCCAGG -3'

Sequencing Primer
(F):5'- ACAAATGTGTTGGGAGTTTAAGCCC -3'
(R):5'- ACTTGTGAATTCCAGGTGACC -3'

Posted On

2014-08-25