Mutagenetix > Incidental Mutation

Incidental Mutation 'R2020:Dhx38'

223848

Institutional Source

Beutler Lab

Gene Symbol

Dhx38

Ensembl Gene

ENSMUSG00000037993

Gene Name

DEAH (Asp-Glu-Ala-His) box polypeptide 38

Synonyms

5730550P09Rik, Ddx38, Prp16

MMRRC Submission

040029-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.966) question?

Stock #

R2020 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

109548011-109565861 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

G to A at 109556869 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000047865 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042601]

AlphaFold

Q80X98

Predicted Effect

probably benign
Transcript: ENSMUST00000042601

SMART Domains

Protein: ENSMUSP00000047865
Gene: ENSMUSG00000037993

Domain	Start	End	E-Value	Type
Blast:DEXDc	3	146	2e-46	BLAST
low complexity region	147	204	N/A	INTRINSIC
Blast:DEXDc	205	444	1e-105	BLAST
low complexity region	511	525	N/A	INTRINSIC
DEXDc	531	715	6.88e-34	SMART
HELICc	759	862	1.11e-19	SMART
HA2	923	1013	3.22e-32	SMART
low complexity region	1163	1194	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212667

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 93.6%

Validation Efficiency

99% (87/88)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The protein encoded by this gene is a member of the DEAD/H box family of splicing factors. This protein resembles yeast Prp16 more closely than other DEAD/H family members. It is an ATPase and essential for the catalytic step II in pre-mRNA splicing process. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600012P17Rik	C	A	1: 158,968,912		noncoding transcript	Het
9530053A07Rik	T	C	7: 28,155,594	S1882P	probably benign	Het
Adam17	G	A	12: 21,349,875	R177C	probably damaging	Het
Ak7	G	A	12: 105,745,332		probably null	Het
Akap9	T	C	5: 3,961,967	V890A	probably damaging	Het
Alg6	A	G	4: 99,738,132	N59S	probably damaging	Het
Alkbh5	G	T	11: 60,538,549	A43S	probably benign	Het
Anxa2	C	A	9: 69,483,817	D162E	probably damaging	Het
Arap1	A	G	7: 101,401,518	H1136R	probably benign	Het
Arhgap18	A	G	10: 26,854,904	R121G	probably benign	Het
Arhgef4	A	T	1: 34,723,810	T716S	unknown	Het
Atg2a	T	C	19: 6,250,269		probably null	Het
Ccdc27	T	C	4: 154,033,313	I480V	probably null	Het
Cdipt	T	C	7: 126,976,933	V20A	possibly damaging	Het
Cgrrf1	C	T	14: 46,830,445		probably benign	Het
Chd7	G	A	4: 8,855,226	V2152I	probably benign	Het
Chd8	T	A	14: 52,215,241	S1274C	probably damaging	Het
Chuk	A	T	19: 44,107,343	M17K	possibly damaging	Het
Col14a1	C	T	15: 55,446,181		probably benign	Het
Col20a1	G	A	2: 181,013,163		probably null	Het
Cped1	A	G	6: 22,143,964	I570V	probably benign	Het
Cul9	C	G	17: 46,522,175	A1326P	probably damaging	Het
Ddx27	A	C	2: 167,033,771	Q674P	probably damaging	Het
Dennd6a	T	A	14: 26,612,003	F131L	probably damaging	Het
Dido1	G	T	2: 180,659,585	N2175K	unknown	Het
Dmxl1	T	A	18: 49,889,558	Y1654*	probably null	Het
Dock7	T	A	4: 98,959,101	H1658L	probably damaging	Het
Dync2h1	T	A	9: 7,122,772	E2061D	probably damaging	Het
Dync2h1	T	C	9: 7,162,925	I555V	probably benign	Het
Eif2ak2	T	C	17: 78,863,963	E337G	possibly damaging	Het
Fabp12	T	A	3: 10,250,149	D46V	probably benign	Het
Fech	C	T	18: 64,478,727	E79K	probably damaging	Het
Flnc	A	T	6: 29,444,363	I693F	probably damaging	Het
Foxp2	G	A	6: 15,324,644	C97Y	possibly damaging	Het
Grin2b	A	G	6: 135,733,896	M884T	probably benign	Het
Gtf2ird1	T	C	5: 134,417,093	D28G	probably damaging	Het
Gtf3c4	C	A	2: 28,833,894	G468W	possibly damaging	Het
Ift172	A	T	5: 31,267,241	L201*	probably null	Het
Il1rl2	C	A	1: 40,365,214	S498R	probably damaging	Het
Ildr1	C	T	16: 36,725,541	R489W	probably damaging	Het
Itga10	G	A	3: 96,652,490	G487D	probably damaging	Het
Klk8	A	G	7: 43,799,216	N128D	probably benign	Het
Lgr6	G	A	1: 135,075,275	T79M	probably damaging	Het
Med6	T	C	12: 81,573,877	T232A	probably benign	Het
Mgat4e	A	G	1: 134,541,322	L328P	probably damaging	Het
Mttp	A	G	3: 138,118,402	Y138H	probably damaging	Het
Ngef	T	C	1: 87,545,968	R31G	probably benign	Het
Nipsnap2	C	A	5: 129,753,223		probably null	Het
Nlgn2	G	T	11: 69,828,441	N194K	probably damaging	Het
Olfr1026	A	G	2: 85,923,743	I158M	probably benign	Het
Olfr1245	A	T	2: 89,574,961	M255K	possibly damaging	Het
Olfr1450	G	A	19: 12,954,332	V248I	possibly damaging	Het
Olfr357	G	A	2: 36,997,652	V281M	possibly damaging	Het
Olfr894	A	G	9: 38,219,432	Y203C	possibly damaging	Het
Pcca	T	A	14: 122,813,222	M101K	possibly damaging	Het
Plekha6	A	G	1: 133,284,970	T671A	possibly damaging	Het
Prex2	G	A	1: 11,162,312	V868M	probably damaging	Het
Prkcq	G	A	2: 11,279,521	V501I	probably benign	Het
Prom1	T	A	5: 44,011,253		probably benign	Het
Ptprd	A	G	4: 76,133,161	V41A	probably damaging	Het
Rab39	C	T	9: 53,686,398	G189E	possibly damaging	Het
Ret	T	C	6: 118,180,382	K236E	possibly damaging	Het
Rfx6	G	A	10: 51,720,057		probably null	Het
Rnf213	A	G	11: 119,461,918	T3916A	probably damaging	Het
Rpn1	A	G	6: 88,095,683	N336S	probably damaging	Het
Sag	G	A	1: 87,805,315	A2T	probably damaging	Het
Sco2	T	C	15: 89,371,860	Y197C	probably damaging	Het
Sec23b	T	C	2: 144,566,944	I183T	possibly damaging	Het
Sec24b	C	T	3: 129,987,728	V1166M	probably damaging	Het
Slc27a5	A	T	7: 12,993,412	F361Y	probably damaging	Het
Spaca9	A	G	2: 28,696,001	L17P	probably damaging	Het
Sqor	T	C	2: 122,804,107		probably null	Het
Stx18	A	G	5: 38,135,244	H230R	probably damaging	Het
Tas2r130	A	T	6: 131,630,769	I21N	probably damaging	Het
Tcaf3	A	G	6: 42,593,724	S365P	possibly damaging	Het
Tinagl1	G	A	4: 130,166,972	H351Y	probably damaging	Het
Tmc2	T	C	2: 130,232,385	Y333H	probably damaging	Het
Trp53bp2	A	T	1: 182,442,819	T395S	probably damaging	Het
Tsc22d1	T	C	14: 76,418,333	S751P	probably damaging	Het
Ttc30a1	A	G	2: 75,980,935	V268A	probably benign	Het
Ttn	A	G	2: 76,827,024		probably benign	Het
Ugdh	T	C	5: 65,416,925	Y425C	probably damaging	Het
Vmn1r115	G	A	7: 20,844,169	L273F	probably null	Het
Vmn2r109	A	T	17: 20,541,186	C636*	probably null	Het
Vmn2r59	A	C	7: 42,043,779	Y466D	probably damaging	Het
Zic5	C	T	14: 122,464,830	G163D	unknown	Het

Other mutations in Dhx38

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00508:Dhx38	APN	8	109556934	missense	possibly damaging	0.49
IGL00821:Dhx38	APN	8	109555654	missense	probably benign	0.00
IGL00910:Dhx38	APN	8	109559034	missense	probably benign	0.07
IGL01011:Dhx38	APN	8	109562691	missense	probably benign
IGL01401:Dhx38	APN	8	109552114	missense	probably benign	0.15
IGL02133:Dhx38	APN	8	109558241	nonsense	probably null
IGL02529:Dhx38	APN	8	109559013	missense	probably benign	0.00
IGL02652:Dhx38	APN	8	109556129	missense	probably damaging	1.00
IGL03241:Dhx38	APN	8	109562656	missense	possibly damaging	0.47
IGL03378:Dhx38	APN	8	109559090	splice site	probably null
R0358:Dhx38	UTSW	8	109552462	missense	probably benign	0.13
R0375:Dhx38	UTSW	8	109555181	missense	possibly damaging	0.89
R0437:Dhx38	UTSW	8	109558629	splice site	probably benign
R0481:Dhx38	UTSW	8	109556216	splice site	probably benign
R0492:Dhx38	UTSW	8	109561944	splice site	probably benign
R0528:Dhx38	UTSW	8	109562661	missense	probably benign	0.00
R0607:Dhx38	UTSW	8	109558943	missense	probably benign	0.07
R1638:Dhx38	UTSW	8	109553545	missense	probably damaging	1.00
R2056:Dhx38	UTSW	8	109562720	unclassified	probably benign
R2096:Dhx38	UTSW	8	109554259	missense	probably damaging	1.00
R2152:Dhx38	UTSW	8	109560674	missense	probably benign	0.00
R2154:Dhx38	UTSW	8	109560674	missense	probably benign	0.00
R2382:Dhx38	UTSW	8	109556140	missense	probably damaging	0.99
R4367:Dhx38	UTSW	8	109553131	missense	probably damaging	1.00
R4368:Dhx38	UTSW	8	109553131	missense	probably damaging	1.00
R4369:Dhx38	UTSW	8	109553131	missense	probably damaging	1.00
R5250:Dhx38	UTSW	8	109556520	missense	probably damaging	1.00
R5354:Dhx38	UTSW	8	109555746	missense	probably damaging	1.00
R5668:Dhx38	UTSW	8	109553416	missense	probably damaging	1.00
R5777:Dhx38	UTSW	8	109556902	missense	possibly damaging	0.81
R5784:Dhx38	UTSW	8	109559613	nonsense	probably null
R6799:Dhx38	UTSW	8	109553202	missense	probably damaging	1.00
R6915:Dhx38	UTSW	8	109559599	missense	probably benign	0.15
R6932:Dhx38	UTSW	8	109552675	missense	probably damaging	1.00
R7042:Dhx38	UTSW	8	109556985	missense	possibly damaging	0.55
R7248:Dhx38	UTSW	8	109558927	missense	probably benign	0.15
R7394:Dhx38	UTSW	8	109556523	missense	probably damaging	1.00
R7513:Dhx38	UTSW	8	109560589	missense	probably benign	0.00
R7569:Dhx38	UTSW	8	109560695	missense	probably damaging	0.98
R8003:Dhx38	UTSW	8	109556140	missense	probably damaging	0.99
R8071:Dhx38	UTSW	8	109558701	missense	probably benign	0.10
R8537:Dhx38	UTSW	8	109553380	missense	probably damaging	1.00
R8852:Dhx38	UTSW	8	109562729	nonsense	probably null
R8860:Dhx38	UTSW	8	109562729	nonsense	probably null
R8937:Dhx38	UTSW	8	109556466	missense	probably damaging	0.96
R9099:Dhx38	UTSW	8	109556151	missense	probably damaging	1.00
Z1177:Dhx38	UTSW	8	109556085	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AACCAGCATCTTATGGGGCTTC -3'
(R):5'- CATTCTTGGGAGCAGGAAGG -3'

Sequencing Primer
(F):5'- TTCCACATGAGATGCCAGG -3'
(R):5'- CTAACTTCAGCCTGAGGGACAGTG -3'

Posted On

2014-08-25