Incidental Mutation 'R1993:Bod1l'
ID223855
Institutional Source Beutler Lab
Gene Symbol Bod1l
Ensembl Gene ENSMUSG00000061755
Gene Namebiorientation of chromosomes in cell division 1-like
SynonymsA230054D04Rik
MMRRC Submission 040004-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.938) question?
Stock #R1993 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location41787538-41844315 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 41817336 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 2212 (S2212P)
Ref Sequence ENSEMBL: ENSMUSP00000144359 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050556] [ENSMUST00000202908]
Predicted Effect probably damaging
Transcript: ENSMUST00000050556
AA Change: S2212P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058618
Gene: ENSMUSG00000061755
AA Change: S2212P

DomainStartEndE-ValueType
low complexity region 5 47 N/A INTRINSIC
Pfam:COMPASS-Shg1 54 150 1.8e-28 PFAM
low complexity region 328 343 N/A INTRINSIC
low complexity region 415 435 N/A INTRINSIC
low complexity region 475 484 N/A INTRINSIC
coiled coil region 495 520 N/A INTRINSIC
coiled coil region 553 580 N/A INTRINSIC
low complexity region 820 840 N/A INTRINSIC
low complexity region 895 916 N/A INTRINSIC
low complexity region 996 1005 N/A INTRINSIC
low complexity region 1023 1041 N/A INTRINSIC
low complexity region 1272 1286 N/A INTRINSIC
low complexity region 1791 1809 N/A INTRINSIC
low complexity region 2695 2701 N/A INTRINSIC
low complexity region 2711 2729 N/A INTRINSIC
AT_hook 2807 2819 3.21e-1 SMART
coiled coil region 2908 2929 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201291
Predicted Effect probably damaging
Transcript: ENSMUST00000202908
AA Change: S2212P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144359
Gene: ENSMUSG00000061755
AA Change: S2212P

DomainStartEndE-ValueType
low complexity region 5 47 N/A INTRINSIC
Pfam:COMPASS-Shg1 54 150 2.9e-24 PFAM
low complexity region 328 343 N/A INTRINSIC
low complexity region 415 435 N/A INTRINSIC
low complexity region 475 484 N/A INTRINSIC
coiled coil region 495 520 N/A INTRINSIC
coiled coil region 553 580 N/A INTRINSIC
low complexity region 820 840 N/A INTRINSIC
low complexity region 895 916 N/A INTRINSIC
low complexity region 996 1005 N/A INTRINSIC
low complexity region 1023 1041 N/A INTRINSIC
low complexity region 1272 1286 N/A INTRINSIC
low complexity region 1791 1809 N/A INTRINSIC
low complexity region 2695 2701 N/A INTRINSIC
low complexity region 2711 2729 N/A INTRINSIC
AT_hook 2807 2819 1.9e-3 SMART
coiled coil region 2908 2929 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T G 5: 8,821,322 I292S possibly damaging Het
Abcc4 T C 14: 118,526,282 N1047S probably benign Het
Abcc8 G T 7: 46,117,423 probably null Het
Akap9 T A 5: 4,038,520 probably null Het
Alox5 T A 6: 116,415,463 I366F probably damaging Het
Amn A G 12: 111,276,092 N447S probably damaging Het
Ankrd22 A T 19: 34,165,774 M1K probably null Het
Asic1 G T 15: 99,671,884 G29C probably damaging Het
Atxn7l1 A G 12: 33,345,977 N235S probably benign Het
AY358078 T A 14: 51,826,062 D388E probably damaging Het
Cacna1e T A 1: 154,477,817 Q423L probably damaging Het
Calu T C 6: 29,366,975 I62T possibly damaging Het
Cars2 A G 8: 11,514,515 V75A probably benign Het
Catsperb T A 12: 101,602,767 N899K possibly damaging Het
Ccdc50 T A 16: 27,409,339 C86* probably null Het
Cdh5 G T 8: 104,137,815 L469F probably damaging Het
Clrn3 A T 7: 135,514,119 D167E probably benign Het
Csmd1 A T 8: 16,346,684 C411S probably damaging Het
Dchs1 A T 7: 105,762,548 S1454T probably benign Het
Ddx20 G A 3: 105,679,344 Q562* probably null Het
Dgkg T G 16: 22,600,594 Y52S probably damaging Het
Dhx58 T C 11: 100,703,490 probably null Het
Dpp6 A T 5: 27,399,006 I145L probably benign Het
Efna2 A T 10: 80,186,877 Y85F possibly damaging Het
Eif3a C T 19: 60,781,516 V127I probably benign Het
Exph5 A T 9: 53,373,635 H672L possibly damaging Het
Fam131b T C 6: 42,320,884 T112A possibly damaging Het
Fam71e2 A T 7: 4,758,018 V565E probably damaging Het
Fcgr1 A T 3: 96,285,868 V271E probably damaging Het
Fgfr4 A G 13: 55,165,902 D508G probably damaging Het
Fndc3b A G 3: 27,419,400 M1172T probably benign Het
Fryl G T 5: 73,108,493 T495K probably damaging Het
Gm5134 A T 10: 75,966,393 I93F probably damaging Het
Gpbar1 G A 1: 74,279,444 G282D possibly damaging Het
Gria2 G A 3: 80,802,357 L10F probably benign Het
Grm7 T C 6: 111,207,808 Y367H probably benign Het
Hils1 T A 11: 94,968,032 V51E probably damaging Het
Hivep1 G A 13: 42,157,493 A1070T probably benign Het
Il33 A G 19: 29,956,904 D155G possibly damaging Het
Kdm6b T C 11: 69,406,303 S408G probably null Het
Kntc1 G A 5: 123,759,099 probably null Het
Kntc1 A G 5: 123,810,811 probably null Het
Ltbp2 T G 12: 84,808,446 probably null Het
Mapk8ip3 G T 17: 24,914,588 L83I probably damaging Het
Meltf C A 16: 31,892,622 Y554* probably null Het
Mov10 A C 3: 104,799,419 F725C probably damaging Het
Ms4a6d A C 19: 11,590,159 L18R probably damaging Het
Naip2 T C 13: 100,162,007 N507S probably benign Het
Nodal A G 10: 61,418,334 Q12R probably benign Het
Npy6r T C 18: 44,276,508 L332P probably damaging Het
Nrxn3 A G 12: 89,260,411 K272R possibly damaging Het
Obox2 G T 7: 15,397,249 K93N probably benign Het
Olfr1136 C T 2: 87,693,433 V150M probably benign Het
Olfr1408 C T 1: 173,130,851 R122H possibly damaging Het
Olfr1466 A G 19: 13,341,814 T19A possibly damaging Het
Olfr575 G T 7: 102,954,746 P285Q probably damaging Het
Pcdh12 T A 18: 38,282,143 D643V possibly damaging Het
Pcsk2 A G 2: 143,687,619 D112G probably benign Het
Pms1 A G 1: 53,195,015 S781P probably benign Het
Prtg A G 9: 72,844,896 D188G probably benign Het
Psg21 A T 7: 18,654,770 N132K probably benign Het
Psip1 A G 4: 83,482,532 V25A probably damaging Het
Psmd13 T A 7: 140,898,194 I319N probably damaging Het
Ptges2 A G 2: 32,400,092 T173A probably benign Het
Ptprm G A 17: 66,747,160 R975W probably damaging Het
Rdh1 A G 10: 127,765,345 D254G probably benign Het
Rnf138 T G 18: 21,024,483 N212K probably damaging Het
Serpine2 A G 1: 79,821,442 S32P probably damaging Het
Serpini1 G T 3: 75,614,664 W154L probably damaging Het
Sf3a1 C A 11: 4,179,177 Q713K possibly damaging Het
Sgo2b A T 8: 63,926,833 H988Q probably benign Het
Sin3a T C 9: 57,101,199 F468L probably damaging Het
Slamf6 A T 1: 171,934,209 I66F possibly damaging Het
Slc22a28 A T 19: 8,117,124 C178S possibly damaging Het
Slc35a1 A C 4: 34,675,181 V119G probably damaging Het
Slc39a12 A T 2: 14,434,219 H428L probably damaging Het
Speer2 A G 16: 69,858,077 S167P probably benign Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Spsb2 T C 6: 124,809,366 probably null Het
Stam2 A T 2: 52,703,156 Y341* probably null Het
Sv2b G A 7: 75,206,341 A67V probably benign Het
Svep1 A G 4: 58,064,170 probably null Het
Syt15 A T 14: 34,223,012 Q172L probably benign Het
T G A 17: 8,441,802 S415N probably benign Het
Tep1 A G 14: 50,824,184 F2625S possibly damaging Het
Tex14 T C 11: 87,536,755 V11A possibly damaging Het
Tiam2 A T 17: 3,415,126 R377* probably null Het
Tirap A G 9: 35,191,016 probably null Het
Tm4sf20 T C 1: 82,760,217 T118A probably benign Het
Trank1 A T 9: 111,378,832 Q1715L probably benign Het
Trpm2 C T 10: 77,947,989 V217M probably damaging Het
Ubap1l G A 9: 65,371,796 E126K possibly damaging Het
Urgcp G T 11: 5,716,526 P604Q probably damaging Het
Vmn1r63 A G 7: 5,803,255 V126A probably benign Het
Vmn2r90 T C 17: 17,713,263 C362R probably damaging Het
Vmn2r96 A G 17: 18,583,876 I271V probably damaging Het
Vps13a A T 19: 16,722,458 I740K probably benign Het
Vps13c A G 9: 67,975,856 T3562A probably damaging Het
Wdr91 T A 6: 34,892,362 H409L probably damaging Het
Wnt7a T A 6: 91,365,956 T315S possibly damaging Het
Zfp616 A G 11: 74,084,969 H688R probably benign Het
Zfp763 A T 17: 33,018,439 H577Q probably damaging Het
Zfp808 G A 13: 62,172,907 S650N probably benign Het
Zfp977 A T 7: 42,579,985 M372K probably benign Het
Other mutations in Bod1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Bod1l APN 5 41816823 missense probably benign 0.00
IGL00990:Bod1l APN 5 41828865 missense probably benign 0.00
IGL01021:Bod1l APN 5 41838173 splice site probably benign
IGL01022:Bod1l APN 5 41794309 missense probably damaging 1.00
IGL01303:Bod1l APN 5 41817599 missense probably benign 0.00
IGL01654:Bod1l APN 5 41818176 missense probably damaging 0.99
IGL01748:Bod1l APN 5 41816961 missense probably benign 0.23
IGL01758:Bod1l APN 5 41826610 splice site probably benign
IGL01783:Bod1l APN 5 41808712 missense probably benign 0.02
IGL01790:Bod1l APN 5 41832250 missense probably benign 0.14
IGL01803:Bod1l APN 5 41817389 missense probably damaging 0.97
IGL01829:Bod1l APN 5 41820468 missense probably benign 0.25
IGL01952:Bod1l APN 5 41816954 missense possibly damaging 0.70
IGL02005:Bod1l APN 5 41816339 missense probably benign 0.01
IGL02110:Bod1l APN 5 41816453 missense probably damaging 0.97
IGL02129:Bod1l APN 5 41821850 missense probably benign 0.36
IGL02572:Bod1l APN 5 41821230 nonsense probably null
IGL02583:Bod1l APN 5 41816207 critical splice donor site probably null
IGL02643:Bod1l APN 5 41818805 missense possibly damaging 0.65
IGL02714:Bod1l APN 5 41816339 missense probably benign 0.01
IGL02728:Bod1l APN 5 41826503 missense probably damaging 1.00
IGL02752:Bod1l APN 5 41816463 missense possibly damaging 0.58
IGL02822:Bod1l APN 5 41794345 missense possibly damaging 0.94
IGL03032:Bod1l APN 5 41831584 missense probably benign 0.16
IGL03372:Bod1l APN 5 41805235 splice site probably benign
R0102:Bod1l UTSW 5 41817269 missense probably benign 0.36
R0147:Bod1l UTSW 5 41818697 missense possibly damaging 0.48
R0148:Bod1l UTSW 5 41818697 missense possibly damaging 0.48
R0490:Bod1l UTSW 5 41821892 missense probably damaging 0.96
R0577:Bod1l UTSW 5 41794887 missense probably damaging 1.00
R0587:Bod1l UTSW 5 41821637 missense probably benign 0.16
R0620:Bod1l UTSW 5 41801233 missense probably benign 0.16
R0626:Bod1l UTSW 5 41831537 missense probably damaging 1.00
R0785:Bod1l UTSW 5 41820016 missense probably benign 0.00
R1139:Bod1l UTSW 5 41831471 missense possibly damaging 0.64
R1165:Bod1l UTSW 5 41821053 missense probably benign 0.02
R1418:Bod1l UTSW 5 41819471 missense probably damaging 1.00
R1509:Bod1l UTSW 5 41819540 missense probably damaging 0.99
R1533:Bod1l UTSW 5 41822155 nonsense probably null
R1538:Bod1l UTSW 5 41816429 missense probably benign 0.00
R1591:Bod1l UTSW 5 41819220 missense probably benign 0.06
R1616:Bod1l UTSW 5 41808715 missense probably benign
R1628:Bod1l UTSW 5 41816982 missense probably benign 0.01
R1667:Bod1l UTSW 5 41816775 missense probably benign 0.01
R1869:Bod1l UTSW 5 41833675 missense possibly damaging 0.93
R1870:Bod1l UTSW 5 41833675 missense possibly damaging 0.93
R2060:Bod1l UTSW 5 41808742 missense possibly damaging 0.58
R2066:Bod1l UTSW 5 41805156 missense probably damaging 0.99
R2067:Bod1l UTSW 5 41817086 missense probably benign 0.11
R2073:Bod1l UTSW 5 41819189 missense probably benign 0.19
R2092:Bod1l UTSW 5 41831517 missense probably damaging 1.00
R2105:Bod1l UTSW 5 41832279 missense probably benign 0.00
R2243:Bod1l UTSW 5 41821545 missense possibly damaging 0.58
R2322:Bod1l UTSW 5 41827120 missense probably benign 0.09
R2849:Bod1l UTSW 5 41838076 missense probably damaging 1.00
R2883:Bod1l UTSW 5 41832259 missense probably benign 0.03
R3037:Bod1l UTSW 5 41822037 missense probably damaging 0.99
R3910:Bod1l UTSW 5 41817098 missense probably damaging 0.99
R3911:Bod1l UTSW 5 41817098 missense probably damaging 0.99
R3962:Bod1l UTSW 5 41808721 missense probably benign 0.07
R4235:Bod1l UTSW 5 41821455 missense probably damaging 1.00
R4308:Bod1l UTSW 5 41791813 missense possibly damaging 0.91
R4414:Bod1l UTSW 5 41820527 missense probably benign 0.04
R4535:Bod1l UTSW 5 41832231 missense probably benign 0.06
R4631:Bod1l UTSW 5 41817735 missense probably damaging 1.00
R4657:Bod1l UTSW 5 41818612 missense probably benign 0.00
R4782:Bod1l UTSW 5 41833663 missense probably benign 0.06
R4786:Bod1l UTSW 5 41819438 missense probably benign 0.43
R4840:Bod1l UTSW 5 41818472 missense probably damaging 1.00
R4877:Bod1l UTSW 5 41819994 missense probably benign 0.00
R4982:Bod1l UTSW 5 41820473 missense probably benign 0.00
R5152:Bod1l UTSW 5 41816543 missense probably benign 0.04
R5284:Bod1l UTSW 5 41820467 missense probably benign 0.05
R5354:Bod1l UTSW 5 41831537 missense probably damaging 1.00
R5369:Bod1l UTSW 5 41827183 missense probably damaging 1.00
R5486:Bod1l UTSW 5 41807181 missense possibly damaging 0.56
R5541:Bod1l UTSW 5 41791933 missense probably benign 0.06
R5610:Bod1l UTSW 5 41821874 missense probably damaging 1.00
R5655:Bod1l UTSW 5 41817044 missense probably benign 0.06
R5705:Bod1l UTSW 5 41817002 missense probably benign 0.01
R5819:Bod1l UTSW 5 41832605 missense probably benign 0.27
R5890:Bod1l UTSW 5 41820578 missense probably benign 0.43
R5923:Bod1l UTSW 5 41817419 missense probably damaging 1.00
R5991:Bod1l UTSW 5 41816863 nonsense probably null
R6017:Bod1l UTSW 5 41818760 missense probably benign 0.01
R6253:Bod1l UTSW 5 41826538 missense probably damaging 0.96
R6284:Bod1l UTSW 5 41818787 missense probably benign 0.35
R6483:Bod1l UTSW 5 41821082 missense probably benign 0.03
R6485:Bod1l UTSW 5 41817116 missense possibly damaging 0.93
R6575:Bod1l UTSW 5 41838068 missense probably damaging 1.00
R6679:Bod1l UTSW 5 41816666 missense probably damaging 0.97
R6788:Bod1l UTSW 5 41821873 nonsense probably null
R7006:Bod1l UTSW 5 41832552 missense probably damaging 1.00
R7095:Bod1l UTSW 5 41795068 critical splice donor site probably null
R7111:Bod1l UTSW 5 41813120 critical splice donor site probably null
R7190:Bod1l UTSW 5 41819938 missense probably benign 0.14
R7311:Bod1l UTSW 5 41794333 missense possibly damaging 0.57
R7336:Bod1l UTSW 5 41821524 missense probably damaging 1.00
R7341:Bod1l UTSW 5 41788857 missense probably benign 0.00
R7396:Bod1l UTSW 5 41831546 missense probably damaging 1.00
R7431:Bod1l UTSW 5 41813120 critical splice donor site probably null
R7442:Bod1l UTSW 5 41807179 missense probably damaging 0.96
R7539:Bod1l UTSW 5 41817860 missense possibly damaging 0.65
R7583:Bod1l UTSW 5 41833790 missense probably damaging 1.00
R7679:Bod1l UTSW 5 41820643 frame shift probably null
R7748:Bod1l UTSW 5 41832340 missense probably damaging 0.97
R7767:Bod1l UTSW 5 41816756 missense probably benign 0.01
R7773:Bod1l UTSW 5 41832712 missense probably benign 0.14
R7782:Bod1l UTSW 5 41817943 missense probably benign 0.01
X0027:Bod1l UTSW 5 41832669 missense probably benign 0.20
X0058:Bod1l UTSW 5 41824018 missense probably damaging 1.00
Z1088:Bod1l UTSW 5 41821146 missense probably damaging 1.00
Z1088:Bod1l UTSW 5 41808764 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGGAAATAATGGCAGCATCACTC -3'
(R):5'- TGAGGTACCTATGCCCAGTG -3'

Sequencing Primer
(F):5'- TGGCAGCATCACTCAAATCTTC -3'
(R):5'- GTGCTCCCACTGAAGCTGAAAG -3'
Posted On2014-08-25