Mutagenetix > Incidental Mutation

Incidental Mutation 'R2020:Rnf213'

223869

Institutional Source

Beutler Lab

Gene Symbol

Rnf213

Ensembl Gene

ENSMUSG00000070327

Gene Name

ring finger protein 213

Synonyms

D11Ertd759e

MMRRC Submission

040029-MU

Accession Numbers

Genbank: XM_001477846.2; Ensembl: ENSMUST00000131035, ENSMUST00000082107, ENSMUST00000093902, ENSMUST00000169768, ENSMUST00000172235

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2020 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

119393100-119487418 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 119461918 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 3916 (T3916A)

Ref Sequence

ENSEMBL: ENSMUSP00000115063 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093902] [ENSMUST00000131035]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000093902
AA Change: T3917A

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000091429
Gene: ENSMUSG00000070327
AA Change: T3917A

Domain	Start	End	E-Value	Type
low complexity region	130	146	N/A	INTRINSIC
low complexity region	265	279	N/A	INTRINSIC
low complexity region	319	335	N/A	INTRINSIC
low complexity region	676	688	N/A	INTRINSIC
low complexity region	1114	1128	N/A	INTRINSIC
low complexity region	1546	1558	N/A	INTRINSIC
AAA	2373	2515	2.82e-2	SMART
AAA	2722	2890	3.63e-1	SMART
low complexity region	3449	3459	N/A	INTRINSIC
RING	3947	3985	8.69e-5	SMART
Blast:PP2Ac	4544	4722	3e-66	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000131035
AA Change: T3916A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000115063
Gene: ENSMUSG00000070327
AA Change: T3916A

Domain	Start	End	E-Value	Type
low complexity region	130	146	N/A	INTRINSIC
low complexity region	265	279	N/A	INTRINSIC
low complexity region	319	335	N/A	INTRINSIC
low complexity region	676	688	N/A	INTRINSIC
low complexity region	1113	1127	N/A	INTRINSIC
low complexity region	1545	1557	N/A	INTRINSIC
AAA	2372	2514	2.82e-2	SMART
AAA	2721	2889	3.63e-1	SMART
low complexity region	3448	3458	N/A	INTRINSIC
RING	3946	3984	8.69e-5	SMART
Blast:PP2Ac	4542	4720	3e-66	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207133

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207446

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208476

Meta Mutation Damage Score

0.0978

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 93.6%

Validation Efficiency

99% (87/88)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a C3HC4-type RING finger domain, which is a specialized type of Zn-finger that binds two atoms of zinc and is thought to be involved in mediating protein-protein interactions. The protein also contains an AAA domain, which is associated with ATPase activity. This gene is a susceptibility gene for Moyamoya disease, a vascular disorder of intracranial arteries. This gene is also a translocation partner in anaplastic large cell lymphoma and inflammatory myofibroblastic tumor cases, where a t(2;17)(p23;q25) translocation has been identified with the anaplastic lymphoma kinase (ALK) gene on chromosome 2, and a t(8;17)(q24;q25) translocation has been identified with the MYC gene on chromosome 8. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight and circulating glucose level but normal glucose tolerance, insulin sensitivity, insulin plasma levels and leptin plasma levels. [provided by MGI curators]

Allele List at MGI

All alleles(13) : Targeted, other(2) Gene trapped(11)

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600012P17Rik	C	A	1: 158,968,912 (GRCm38)		noncoding transcript	Het
9530053A07Rik	T	C	7: 28,155,594 (GRCm38)	S1882P	probably benign	Het
Adam17	G	A	12: 21,349,875 (GRCm38)	R177C	probably damaging	Het
Ak7	G	A	12: 105,745,332 (GRCm38)		probably null	Het
Akap9	T	C	5: 3,961,967 (GRCm38)	V890A	probably damaging	Het
Alg6	A	G	4: 99,738,132 (GRCm38)	N59S	probably damaging	Het
Alkbh5	G	T	11: 60,538,549 (GRCm38)	A43S	probably benign	Het
Anxa2	C	A	9: 69,483,817 (GRCm38)	D162E	probably damaging	Het
Arap1	A	G	7: 101,401,518 (GRCm38)	H1136R	probably benign	Het
Arhgap18	A	G	10: 26,854,904 (GRCm38)	R121G	probably benign	Het
Arhgef4	A	T	1: 34,723,810 (GRCm38)	T716S	unknown	Het
Atg2a	T	C	19: 6,250,269 (GRCm38)		probably null	Het
Ccdc27	T	C	4: 154,033,313 (GRCm38)	I480V	probably null	Het
Cdipt	T	C	7: 126,976,933 (GRCm38)	V20A	possibly damaging	Het
Cgrrf1	C	T	14: 46,830,445 (GRCm38)		probably benign	Het
Chd7	G	A	4: 8,855,226 (GRCm38)	V2152I	probably benign	Het
Chd8	T	A	14: 52,215,241 (GRCm38)	S1274C	probably damaging	Het
Chuk	A	T	19: 44,107,343 (GRCm38)	M17K	possibly damaging	Het
Col14a1	C	T	15: 55,446,181 (GRCm38)		probably benign	Het
Col20a1	G	A	2: 181,013,163 (GRCm38)		probably null	Het
Cped1	A	G	6: 22,143,964 (GRCm38)	I570V	probably benign	Het
Cul9	C	G	17: 46,522,175 (GRCm38)	A1326P	probably damaging	Het
Ddx27	A	C	2: 167,033,771 (GRCm38)	Q674P	probably damaging	Het
Dennd6a	T	A	14: 26,612,003 (GRCm38)	F131L	probably damaging	Het
Dhx38	G	A	8: 109,556,869 (GRCm38)		probably benign	Het
Dido1	G	T	2: 180,659,585 (GRCm38)	N2175K	unknown	Het
Dmxl1	T	A	18: 49,889,558 (GRCm38)	Y1654*	probably null	Het
Dock7	T	A	4: 98,959,101 (GRCm38)	H1658L	probably damaging	Het
Dync2h1	T	C	9: 7,162,925 (GRCm38)	I555V	probably benign	Het
Dync2h1	T	A	9: 7,122,772 (GRCm38)	E2061D	probably damaging	Het
Eif2ak2	T	C	17: 78,863,963 (GRCm38)	E337G	possibly damaging	Het
Fabp12	T	A	3: 10,250,149 (GRCm38)	D46V	probably benign	Het
Fech	C	T	18: 64,478,727 (GRCm38)	E79K	probably damaging	Het
Flnc	A	T	6: 29,444,363 (GRCm38)	I693F	probably damaging	Het
Foxp2	G	A	6: 15,324,644 (GRCm38)	C97Y	possibly damaging	Het
Grin2b	A	G	6: 135,733,896 (GRCm38)	M884T	probably benign	Het
Gtf2ird1	T	C	5: 134,417,093 (GRCm38)	D28G	probably damaging	Het
Gtf3c4	C	A	2: 28,833,894 (GRCm38)	G468W	possibly damaging	Het
Ift172	A	T	5: 31,267,241 (GRCm38)	L201*	probably null	Het
Il1rl2	C	A	1: 40,365,214 (GRCm38)	S498R	probably damaging	Het
Ildr1	C	T	16: 36,725,541 (GRCm38)	R489W	probably damaging	Het
Itga10	G	A	3: 96,652,490 (GRCm38)	G487D	probably damaging	Het
Klk8	A	G	7: 43,799,216 (GRCm38)	N128D	probably benign	Het
Lgr6	G	A	1: 135,075,275 (GRCm38)	T79M	probably damaging	Het
Med6	T	C	12: 81,573,877 (GRCm38)	T232A	probably benign	Het
Mgat4e	A	G	1: 134,541,322 (GRCm38)	L328P	probably damaging	Het
Mttp	A	G	3: 138,118,402 (GRCm38)	Y138H	probably damaging	Het
Ngef	T	C	1: 87,545,968 (GRCm38)	R31G	probably benign	Het
Nipsnap2	C	A	5: 129,753,223 (GRCm38)		probably null	Het
Nlgn2	G	T	11: 69,828,441 (GRCm38)	N194K	probably damaging	Het
Olfr1026	A	G	2: 85,923,743 (GRCm38)	I158M	probably benign	Het
Olfr1245	A	T	2: 89,574,961 (GRCm38)	M255K	possibly damaging	Het
Olfr1450	G	A	19: 12,954,332 (GRCm38)	V248I	possibly damaging	Het
Olfr357	G	A	2: 36,997,652 (GRCm38)	V281M	possibly damaging	Het
Olfr894	A	G	9: 38,219,432 (GRCm38)	Y203C	possibly damaging	Het
Pcca	T	A	14: 122,813,222 (GRCm38)	M101K	possibly damaging	Het
Plekha6	A	G	1: 133,284,970 (GRCm38)	T671A	possibly damaging	Het
Prex2	G	A	1: 11,162,312 (GRCm38)	V868M	probably damaging	Het
Prkcq	G	A	2: 11,279,521 (GRCm38)	V501I	probably benign	Het
Prom1	T	A	5: 44,011,253 (GRCm38)		probably benign	Het
Ptprd	A	G	4: 76,133,161 (GRCm38)	V41A	probably damaging	Het
Rab39	C	T	9: 53,686,398 (GRCm38)	G189E	possibly damaging	Het
Ret	T	C	6: 118,180,382 (GRCm38)	K236E	possibly damaging	Het
Rfx6	G	A	10: 51,720,057 (GRCm38)		probably null	Het
Rpn1	A	G	6: 88,095,683 (GRCm38)	N336S	probably damaging	Het
Sag	G	A	1: 87,805,315 (GRCm38)	A2T	probably damaging	Het
Sco2	T	C	15: 89,371,860 (GRCm38)	Y197C	probably damaging	Het
Sec23b	T	C	2: 144,566,944 (GRCm38)	I183T	possibly damaging	Het
Sec24b	C	T	3: 129,987,728 (GRCm38)	V1166M	probably damaging	Het
Slc27a5	A	T	7: 12,993,412 (GRCm38)	F361Y	probably damaging	Het
Spaca9	A	G	2: 28,696,001 (GRCm38)	L17P	probably damaging	Het
Sqor	T	C	2: 122,804,107 (GRCm38)		probably null	Het
Stx18	A	G	5: 38,135,244 (GRCm38)	H230R	probably damaging	Het
Tas2r130	A	T	6: 131,630,769 (GRCm38)	I21N	probably damaging	Het
Tcaf3	A	G	6: 42,593,724 (GRCm38)	S365P	possibly damaging	Het
Tinagl1	G	A	4: 130,166,972 (GRCm38)	H351Y	probably damaging	Het
Tmc2	T	C	2: 130,232,385 (GRCm38)	Y333H	probably damaging	Het
Trp53bp2	A	T	1: 182,442,819 (GRCm38)	T395S	probably damaging	Het
Tsc22d1	T	C	14: 76,418,333 (GRCm38)	S751P	probably damaging	Het
Ttc30a1	A	G	2: 75,980,935 (GRCm38)	V268A	probably benign	Het
Ttn	A	G	2: 76,827,024 (GRCm38)		probably benign	Het
Ugdh	T	C	5: 65,416,925 (GRCm38)	Y425C	probably damaging	Het
Vmn1r115	G	A	7: 20,844,169 (GRCm38)	L273F	probably null	Het
Vmn2r109	A	T	17: 20,541,186 (GRCm38)	C636*	probably null	Het
Vmn2r59	A	C	7: 42,043,779 (GRCm38)	Y466D	probably damaging	Het
Zic5	C	T	14: 122,464,830 (GRCm38)	G163D	unknown	Het

Other mutations in Rnf213

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Rnf213	APN	11	119,449,343 (GRCm38)	missense	probably benign	0.00
IGL00961:Rnf213	APN	11	119,440,843 (GRCm38)	missense	possibly damaging	0.55
IGL01324:Rnf213	APN	11	119,447,237 (GRCm38)	missense	probably damaging	1.00
IGL01351:Rnf213	APN	11	119,483,118 (GRCm38)	missense	probably benign	0.25
IGL01403:Rnf213	APN	11	119,443,300 (GRCm38)	missense	probably damaging	1.00
IGL01704:Rnf213	APN	11	119,449,876 (GRCm38)	critical splice donor site	probably null
IGL01765:Rnf213	APN	11	119,436,352 (GRCm38)	missense	probably benign	0.00
IGL01803:Rnf213	APN	11	119,441,307 (GRCm38)	missense	probably damaging	1.00
IGL01804:Rnf213	APN	11	119,442,266 (GRCm38)	missense	probably damaging	1.00
IGL01900:Rnf213	APN	11	119,443,015 (GRCm38)	missense	probably benign	0.05
IGL01944:Rnf213	APN	11	119,416,457 (GRCm38)	missense	probably benign	0.01
IGL01982:Rnf213	APN	11	119,443,268 (GRCm38)	missense	probably damaging	1.00
IGL02008:Rnf213	APN	11	119,418,309 (GRCm38)	splice site	probably benign
IGL02084:Rnf213	APN	11	119,445,673 (GRCm38)	missense	probably benign	0.04
IGL02253:Rnf213	APN	11	119,440,650 (GRCm38)	missense	probably benign	0.03
IGL02254:Rnf213	APN	11	119,480,907 (GRCm38)	missense	possibly damaging	0.89
IGL02296:Rnf213	APN	11	119,463,336 (GRCm38)	missense	probably benign	0.01
IGL02531:Rnf213	APN	11	119,436,802 (GRCm38)	missense	probably benign
IGL02588:Rnf213	APN	11	119,416,536 (GRCm38)	missense	probably benign	0.30
IGL02615:Rnf213	APN	11	119,440,789 (GRCm38)	missense	probably damaging	0.96
IGL02805:Rnf213	APN	11	119,435,066 (GRCm38)	missense	probably damaging	0.99
IGL02887:Rnf213	APN	11	119,427,510 (GRCm38)	missense	probably damaging	1.00
IGL03001:Rnf213	APN	11	119,479,941 (GRCm38)	missense	probably damaging	1.00
IGL03035:Rnf213	APN	11	119,445,626 (GRCm38)	splice site	probably benign
IGL03057:Rnf213	APN	11	119,441,087 (GRCm38)	missense	probably damaging	1.00
IGL03148:Rnf213	APN	11	119,465,007 (GRCm38)	missense	probably damaging	1.00
IGL03308:Rnf213	APN	11	119,474,172 (GRCm38)	missense	probably benign	0.03
IGL03339:Rnf213	APN	11	119,443,004 (GRCm38)	missense	probably damaging	1.00
IGL03369:Rnf213	APN	11	119,421,468 (GRCm38)	missense	probably benign	0.34
attrition	UTSW	11	119,430,321 (GRCm38)	missense	possibly damaging	0.77
defame	UTSW	11	119,430,281 (GRCm38)	nonsense	probably null
Derogate	UTSW	11	119,470,210 (GRCm38)	missense	probably damaging	1.00
dinky	UTSW	11	119,416,458 (GRCm38)	missense	probably damaging	0.99
G1funyon_rnf213_024	UTSW	11	119,434,742 (GRCm38)	missense
Impugn	UTSW	11	119,436,823 (GRCm38)	nonsense	probably null
R4332_Rnf213_642	UTSW	11	119,436,676 (GRCm38)	missense	probably damaging	1.00
B6584:Rnf213	UTSW	11	119,426,069 (GRCm38)	missense	probably damaging	0.97
G1Funyon:Rnf213	UTSW	11	119,434,742 (GRCm38)	missense
PIT4585001:Rnf213	UTSW	11	119,458,392 (GRCm38)	missense
R0008:Rnf213	UTSW	11	119,465,052 (GRCm38)	missense	possibly damaging	0.82
R0015:Rnf213	UTSW	11	119,441,606 (GRCm38)	missense	possibly damaging	0.95
R0041:Rnf213	UTSW	11	119,402,575 (GRCm38)	missense	probably benign	0.41
R0114:Rnf213	UTSW	11	119,414,587 (GRCm38)	missense	probably damaging	1.00
R0131:Rnf213	UTSW	11	119,430,361 (GRCm38)	missense	probably benign	0.10
R0131:Rnf213	UTSW	11	119,430,361 (GRCm38)	missense	probably benign	0.10
R0132:Rnf213	UTSW	11	119,430,361 (GRCm38)	missense	probably benign	0.10
R0138:Rnf213	UTSW	11	119,416,496 (GRCm38)	missense	probably benign	0.05
R0144:Rnf213	UTSW	11	119,479,600 (GRCm38)	nonsense	probably null
R0184:Rnf213	UTSW	11	119,414,521 (GRCm38)	missense	probably damaging	0.99
R0321:Rnf213	UTSW	11	119,438,105 (GRCm38)	nonsense	probably null
R0365:Rnf213	UTSW	11	119,426,111 (GRCm38)	missense	possibly damaging	0.74
R0415:Rnf213	UTSW	11	119,414,469 (GRCm38)	missense	probably damaging	1.00
R0421:Rnf213	UTSW	11	119,447,257 (GRCm38)	missense	probably damaging	1.00
R0494:Rnf213	UTSW	11	119,426,012 (GRCm38)	missense	possibly damaging	0.65
R0494:Rnf213	UTSW	11	119,443,120 (GRCm38)	missense	probably damaging	1.00
R0549:Rnf213	UTSW	11	119,465,082 (GRCm38)	missense	probably damaging	1.00
R0577:Rnf213	UTSW	11	119,443,280 (GRCm38)	missense	probably damaging	1.00
R0605:Rnf213	UTSW	11	119,431,717 (GRCm38)	missense	probably benign	0.03
R0638:Rnf213	UTSW	11	119,470,210 (GRCm38)	missense	probably damaging	1.00
R0675:Rnf213	UTSW	11	119,441,834 (GRCm38)	missense	probably benign	0.28
R0715:Rnf213	UTSW	11	119,441,150 (GRCm38)	missense	probably damaging	0.97
R0732:Rnf213	UTSW	11	119,441,068 (GRCm38)	missense	probably damaging	0.99
R0748:Rnf213	UTSW	11	119,473,480 (GRCm38)	missense	probably damaging	1.00
R0765:Rnf213	UTSW	11	119,423,095 (GRCm38)	critical splice donor site	probably null
R0890:Rnf213	UTSW	11	119,430,486 (GRCm38)	missense	possibly damaging	0.94
R0927:Rnf213	UTSW	11	119,414,570 (GRCm38)	missense	probably benign	0.00
R0940:Rnf213	UTSW	11	119,416,563 (GRCm38)	missense	probably benign	0.10
R0959:Rnf213	UTSW	11	119,452,581 (GRCm38)	missense	probably damaging	0.99
R1077:Rnf213	UTSW	11	119,485,998 (GRCm38)	splice site	probably benign
R1104:Rnf213	UTSW	11	119,477,229 (GRCm38)	missense	probably benign	0.29
R1141:Rnf213	UTSW	11	119,435,983 (GRCm38)	missense	probably benign	0.02
R1219:Rnf213	UTSW	11	119,436,177 (GRCm38)	missense	probably damaging	1.00
R1435:Rnf213	UTSW	11	119,436,005 (GRCm38)	missense	probably damaging	1.00
R1444:Rnf213	UTSW	11	119,442,400 (GRCm38)	missense	probably damaging	1.00
R1474:Rnf213	UTSW	11	119,437,750 (GRCm38)	missense	probably damaging	1.00
R1488:Rnf213	UTSW	11	119,480,889 (GRCm38)	missense	probably benign	0.05
R1523:Rnf213	UTSW	11	119,441,888 (GRCm38)	missense	probably damaging	1.00
R1548:Rnf213	UTSW	11	119,442,707 (GRCm38)	missense	probably damaging	1.00
R1554:Rnf213	UTSW	11	119,441,839 (GRCm38)	missense	probably benign	0.06
R1563:Rnf213	UTSW	11	119,414,526 (GRCm38)	missense	probably benign	0.13
R1572:Rnf213	UTSW	11	119,436,611 (GRCm38)	missense	probably damaging	1.00
R1585:Rnf213	UTSW	11	119,463,345 (GRCm38)	missense	probably damaging	1.00
R1635:Rnf213	UTSW	11	119,442,579 (GRCm38)	missense	probably damaging	0.97
R1663:Rnf213	UTSW	11	119,437,672 (GRCm38)	missense	probably benign	0.01
R1789:Rnf213	UTSW	11	119,440,221 (GRCm38)	missense	probably damaging	0.97
R1844:Rnf213	UTSW	11	119,441,183 (GRCm38)	missense	probably damaging	1.00
R1871:Rnf213	UTSW	11	119,450,129 (GRCm38)	missense	probably benign	0.08
R1893:Rnf213	UTSW	11	119,416,448 (GRCm38)	missense	probably damaging	1.00
R1937:Rnf213	UTSW	11	119,431,685 (GRCm38)	missense	probably damaging	1.00
R1967:Rnf213	UTSW	11	119,480,895 (GRCm38)	missense	probably damaging	1.00
R1987:Rnf213	UTSW	11	119,441,107 (GRCm38)	missense	probably damaging	1.00
R2000:Rnf213	UTSW	11	119,436,022 (GRCm38)	missense	probably damaging	1.00
R2100:Rnf213	UTSW	11	119,467,302 (GRCm38)	nonsense	probably null
R2109:Rnf213	UTSW	11	119,442,663 (GRCm38)	nonsense	probably null
R2115:Rnf213	UTSW	11	119,428,013 (GRCm38)	missense	probably benign	0.00
R2126:Rnf213	UTSW	11	119,450,201 (GRCm38)	missense	probably damaging	0.99
R2144:Rnf213	UTSW	11	119,443,690 (GRCm38)	missense	probably damaging	0.99
R2145:Rnf213	UTSW	11	119,415,193 (GRCm38)	missense	probably benign	0.03
R2168:Rnf213	UTSW	11	119,415,070 (GRCm38)	missense	probably damaging	0.97
R2189:Rnf213	UTSW	11	119,430,361 (GRCm38)	missense	probably benign	0.10
R2199:Rnf213	UTSW	11	119,460,009 (GRCm38)	missense	probably benign	0.01
R2220:Rnf213	UTSW	11	119,436,428 (GRCm38)	missense	possibly damaging	0.94
R2336:Rnf213	UTSW	11	119,414,604 (GRCm38)	missense	probably benign	0.02
R2400:Rnf213	UTSW	11	119,443,195 (GRCm38)	missense	probably damaging	1.00
R2679:Rnf213	UTSW	11	119,459,938 (GRCm38)	splice site	probably null
R2698:Rnf213	UTSW	11	119,410,144 (GRCm38)	missense	probably benign	0.26
R3151:Rnf213	UTSW	11	119,468,892 (GRCm38)	missense	probably benign	0.03
R3607:Rnf213	UTSW	11	119,441,976 (GRCm38)	nonsense	probably null
R3808:Rnf213	UTSW	11	119,479,558 (GRCm38)	missense	probably damaging	1.00
R3854:Rnf213	UTSW	11	119,480,939 (GRCm38)	splice site	probably benign
R3856:Rnf213	UTSW	11	119,480,939 (GRCm38)	splice site	probably benign
R3973:Rnf213	UTSW	11	119,469,053 (GRCm38)	missense
R4014:Rnf213	UTSW	11	119,445,729 (GRCm38)	nonsense	probably null
R4049:Rnf213	UTSW	11	119,482,448 (GRCm38)	missense	possibly damaging	0.67
R4130:Rnf213	UTSW	11	119,483,006 (GRCm38)	missense	probably damaging	1.00
R4153:Rnf213	UTSW	11	119,409,482 (GRCm38)	missense	probably benign	0.27
R4167:Rnf213	UTSW	11	119,441,243 (GRCm38)	missense	probably damaging	0.99
R4224:Rnf213	UTSW	11	119,436,823 (GRCm38)	nonsense	probably null
R4332:Rnf213	UTSW	11	119,436,676 (GRCm38)	missense	probably damaging	1.00
R4415:Rnf213	UTSW	11	119,483,964 (GRCm38)	missense	probably damaging	0.99
R4547:Rnf213	UTSW	11	119,479,670 (GRCm38)	critical splice donor site	probably null
R4609:Rnf213	UTSW	11	119,437,695 (GRCm38)	missense	possibly damaging	0.86
R4684:Rnf213	UTSW	11	119,441,125 (GRCm38)	missense	probably damaging	1.00
R4704:Rnf213	UTSW	11	119,440,349 (GRCm38)	missense	probably damaging	1.00
R4719:Rnf213	UTSW	11	119,420,067 (GRCm38)	missense	probably benign	0.38
R4751:Rnf213	UTSW	11	119,445,745 (GRCm38)	missense	probably benign	0.12
R4828:Rnf213	UTSW	11	119,416,629 (GRCm38)	missense	possibly damaging	0.61
R4837:Rnf213	UTSW	11	119,442,763 (GRCm38)	missense	probably benign	0.00
R4894:Rnf213	UTSW	11	119,481,240 (GRCm38)	missense	probably damaging	1.00
R4973:Rnf213	UTSW	11	119,428,157 (GRCm38)	missense	possibly damaging	0.84
R5026:Rnf213	UTSW	11	119,436,764 (GRCm38)	missense	probably damaging	1.00
R5034:Rnf213	UTSW	11	119,410,807 (GRCm38)	missense	probably damaging	0.99
R5284:Rnf213	UTSW	11	119,458,866 (GRCm38)	missense	possibly damaging	0.89
R5295:Rnf213	UTSW	11	119,440,816 (GRCm38)	missense	probably benign	0.00
R5406:Rnf213	UTSW	11	119,440,808 (GRCm38)	missense	probably damaging	1.00
R5441:Rnf213	UTSW	11	119,409,020 (GRCm38)	missense	probably damaging	0.99
R5449:Rnf213	UTSW	11	119,415,076 (GRCm38)	missense	probably benign	0.44
R5520:Rnf213	UTSW	11	119,433,499 (GRCm38)	missense	probably damaging	1.00
R5636:Rnf213	UTSW	11	119,436,905 (GRCm38)	missense	probably damaging	1.00
R5636:Rnf213	UTSW	11	119,436,629 (GRCm38)	missense	probably benign	0.04
R5669:Rnf213	UTSW	11	119,458,785 (GRCm38)	missense	possibly damaging	0.92
R5670:Rnf213	UTSW	11	119,434,686 (GRCm38)	critical splice acceptor site	probably null
R5697:Rnf213	UTSW	11	119,483,894 (GRCm38)	missense	possibly damaging	0.54
R5726:Rnf213	UTSW	11	119,416,458 (GRCm38)	missense	probably damaging	0.99
R5808:Rnf213	UTSW	11	119,436,295 (GRCm38)	missense	probably benign
R5861:Rnf213	UTSW	11	119,473,377 (GRCm38)	missense	probably damaging	1.00
R5903:Rnf213	UTSW	11	119,421,369 (GRCm38)	missense	probably damaging	0.98
R5949:Rnf213	UTSW	11	119,443,079 (GRCm38)	missense	probably damaging	1.00
R6022:Rnf213	UTSW	11	119,486,010 (GRCm38)	missense	probably benign	0.00
R6043:Rnf213	UTSW	11	119,442,101 (GRCm38)	missense	probably damaging	0.97
R6089:Rnf213	UTSW	11	119,416,559 (GRCm38)	missense	probably benign	0.14
R6123:Rnf213	UTSW	11	119,411,513 (GRCm38)	missense	probably damaging	0.96
R6134:Rnf213	UTSW	11	119,411,470 (GRCm38)	missense	probably damaging	0.99
R6135:Rnf213	UTSW	11	119,442,028 (GRCm38)	missense	probably benign	0.02
R6146:Rnf213	UTSW	11	119,435,999 (GRCm38)	missense	probably benign	0.41
R6163:Rnf213	UTSW	11	119,458,428 (GRCm38)	missense	possibly damaging	0.86
R6272:Rnf213	UTSW	11	119,414,548 (GRCm38)	missense	probably damaging	1.00
R6333:Rnf213	UTSW	11	119,463,366 (GRCm38)	missense	probably damaging	1.00
R6370:Rnf213	UTSW	11	119,477,078 (GRCm38)	missense	probably damaging	0.99
R6456:Rnf213	UTSW	11	119,459,966 (GRCm38)	missense	probably benign	0.03
R6468:Rnf213	UTSW	11	119,452,687 (GRCm38)	missense	possibly damaging	0.94
R6579:Rnf213	UTSW	11	119,436,280 (GRCm38)	missense	probably damaging	0.96
R6648:Rnf213	UTSW	11	119,479,920 (GRCm38)	missense	possibly damaging	0.81
R6727:Rnf213	UTSW	11	119,430,321 (GRCm38)	missense	possibly damaging	0.77
R6739:Rnf213	UTSW	11	119,442,271 (GRCm38)	missense	probably damaging	1.00
R6768:Rnf213	UTSW	11	119,442,236 (GRCm38)	missense	probably damaging	0.99
R6817:Rnf213	UTSW	11	119,462,285 (GRCm38)	critical splice donor site	probably null
R6820:Rnf213	UTSW	11	119,448,838 (GRCm38)	missense	probably damaging	1.00
R6841:Rnf213	UTSW	11	119,449,866 (GRCm38)	missense	probably benign	0.26
R6934:Rnf213	UTSW	11	119,420,067 (GRCm38)	missense	probably benign	0.38
R7026:Rnf213	UTSW	11	119,479,655 (GRCm38)	missense	possibly damaging	0.58
R7094:Rnf213	UTSW	11	119,437,604 (GRCm38)	splice site	probably null
R7170:Rnf213	UTSW	11	119,452,575 (GRCm38)	missense
R7185:Rnf213	UTSW	11	119,424,198 (GRCm38)	missense
R7239:Rnf213	UTSW	11	119,458,788 (GRCm38)	missense
R7258:Rnf213	UTSW	11	119,452,575 (GRCm38)	missense
R7259:Rnf213	UTSW	11	119,452,575 (GRCm38)	missense
R7260:Rnf213	UTSW	11	119,452,575 (GRCm38)	missense
R7273:Rnf213	UTSW	11	119,431,756 (GRCm38)	splice site	probably null
R7282:Rnf213	UTSW	11	119,437,992 (GRCm38)	missense
R7311:Rnf213	UTSW	11	119,416,547 (GRCm38)	missense
R7352:Rnf213	UTSW	11	119,443,579 (GRCm38)	missense
R7369:Rnf213	UTSW	11	119,430,468 (GRCm38)	missense
R7410:Rnf213	UTSW	11	119,435,051 (GRCm38)	missense
R7448:Rnf213	UTSW	11	119,481,291 (GRCm38)	missense
R7561:Rnf213	UTSW	11	119,441,719 (GRCm38)	missense
R7573:Rnf213	UTSW	11	119,458,484 (GRCm38)	missense
R7615:Rnf213	UTSW	11	119,467,297 (GRCm38)	missense
R7680:Rnf213	UTSW	11	119,479,556 (GRCm38)	missense
R7739:Rnf213	UTSW	11	119,410,861 (GRCm38)	missense
R7789:Rnf213	UTSW	11	119,470,219 (GRCm38)	splice site	probably null
R7806:Rnf213	UTSW	11	119,411,545 (GRCm38)	missense
R8031:Rnf213	UTSW	11	119,430,281 (GRCm38)	nonsense	probably null
R8042:Rnf213	UTSW	11	119,441,654 (GRCm38)	missense
R8053:Rnf213	UTSW	11	119,402,647 (GRCm38)	missense
R8284:Rnf213	UTSW	11	119,428,083 (GRCm38)	missense
R8301:Rnf213	UTSW	11	119,434,742 (GRCm38)	missense
R8325:Rnf213	UTSW	11	119,430,445 (GRCm38)	missense
R8332:Rnf213	UTSW	11	119,483,698 (GRCm38)	missense
R8443:Rnf213	UTSW	11	119,449,323 (GRCm38)	missense
R8518:Rnf213	UTSW	11	119,462,217 (GRCm38)	missense
R8531:Rnf213	UTSW	11	119,474,205 (GRCm38)	missense	probably benign	0.02
R8670:Rnf213	UTSW	11	119,458,737 (GRCm38)	missense
R8675:Rnf213	UTSW	11	119,456,158 (GRCm38)	missense
R8690:Rnf213	UTSW	11	119,441,212 (GRCm38)	missense
R8690:Rnf213	UTSW	11	119,418,129 (GRCm38)	missense
R8714:Rnf213	UTSW	11	119,468,894 (GRCm38)	missense
R8802:Rnf213	UTSW	11	119,462,102 (GRCm38)	missense
R8861:Rnf213	UTSW	11	119,442,236 (GRCm38)	missense
R8886:Rnf213	UTSW	11	119,473,438 (GRCm38)	missense
R8893:Rnf213	UTSW	11	119,443,042 (GRCm38)	missense
R8937:Rnf213	UTSW	11	119,430,274 (GRCm38)	missense	possibly damaging	0.94
R8941:Rnf213	UTSW	11	119,414,424 (GRCm38)	missense	probably damaging	1.00
R8973:Rnf213	UTSW	11	119,461,930 (GRCm38)	missense
R8983:Rnf213	UTSW	11	119,430,349 (GRCm38)	missense
R9043:Rnf213	UTSW	11	119,458,913 (GRCm38)	missense
R9081:Rnf213	UTSW	11	119,466,236 (GRCm38)	missense
R9132:Rnf213	UTSW	11	119,483,916 (GRCm38)	missense
R9135:Rnf213	UTSW	11	119,408,747 (GRCm38)	missense
R9146:Rnf213	UTSW	11	119,443,673 (GRCm38)	missense
R9156:Rnf213	UTSW	11	119,440,748 (GRCm38)	missense
R9183:Rnf213	UTSW	11	119,427,622 (GRCm38)	missense
R9234:Rnf213	UTSW	11	119,450,117 (GRCm38)	missense
R9275:Rnf213	UTSW	11	119,435,942 (GRCm38)	missense
R9278:Rnf213	UTSW	11	119,435,942 (GRCm38)	missense
R9296:Rnf213	UTSW	11	119,443,795 (GRCm38)	splice site	probably benign
R9350:Rnf213	UTSW	11	119,442,149 (GRCm38)	missense
R9366:Rnf213	UTSW	11	119,436,231 (GRCm38)	missense
R9413:Rnf213	UTSW	11	119,466,233 (GRCm38)	missense
R9444:Rnf213	UTSW	11	119,434,797 (GRCm38)	missense
R9464:Rnf213	UTSW	11	119,463,580 (GRCm38)	missense
R9605:Rnf213	UTSW	11	119,469,053 (GRCm38)	missense
R9649:Rnf213	UTSW	11	119,479,631 (GRCm38)	missense
R9651:Rnf213	UTSW	11	119,440,412 (GRCm38)	missense
R9664:Rnf213	UTSW	11	119,441,968 (GRCm38)	missense
R9696:Rnf213	UTSW	11	119,468,980 (GRCm38)	missense
R9710:Rnf213	UTSW	11	119,441,005 (GRCm38)	missense
R9797:Rnf213	UTSW	11	119,442,539 (GRCm38)	missense
S24628:Rnf213	UTSW	11	119,414,469 (GRCm38)	missense	probably damaging	1.00
X0021:Rnf213	UTSW	11	119,441,824 (GRCm38)	missense	probably benign	0.14
X0062:Rnf213	UTSW	11	119,473,513 (GRCm38)	missense	probably benign	0.05
X0064:Rnf213	UTSW	11	119,440,463 (GRCm38)	missense	probably damaging	1.00
Z1088:Rnf213	UTSW	11	119,477,254 (GRCm38)	missense	possibly damaging	0.69
Z1176:Rnf213	UTSW	11	119,482,998 (GRCm38)	missense
Z1176:Rnf213	UTSW	11	119,441,410 (GRCm38)	missense

Predicted Primers

PCR Primer
(F):5'- GAAAATGTGGGAACTTCCTATGGC -3'
(R):5'- CTCCATGGCAGATGAAACATGG -3'

Sequencing Primer
(F):5'- TGGGAACTTCCTATGGCAAGCATC -3'
(R):5'- CAGATGAAACATGGCTGAATACC -3'

Posted On

2014-08-25