Incidental Mutation 'R2020:Adam17'
ID223871
Institutional Source Beutler Lab
Gene Symbol Adam17
Ensembl Gene ENSMUSG00000052593
Gene Namea disintegrin and metallopeptidase domain 17
SynonymsCD156b, Tace
MMRRC Submission 040029-MU
Accession Numbers

Genbank: NM_009615; MGI: 1096335

Is this an essential gene? Probably essential (E-score: 0.947) question?
Stock #R2020 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location21323509-21373632 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 21349875 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 177 (R177C)
Ref Sequence ENSEMBL: ENSMUSP00000136407 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064536] [ENSMUST00000101551] [ENSMUST00000127974] [ENSMUST00000142092] [ENSMUST00000145118] [ENSMUST00000232107] [ENSMUST00000232526]
Predicted Effect probably damaging
Transcript: ENSMUST00000064536
AA Change: R177C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000067953
Gene: ENSMUSG00000052593
AA Change: R177C

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 28 167 1.1e-11 PFAM
Pfam:Reprolysin_5 221 451 6.7e-37 PFAM
Pfam:Reprolysin_4 221 469 3.2e-24 PFAM
Pfam:Reprolysin_2 244 464 8.8e-29 PFAM
Pfam:Reprolysin_3 248 416 1.2e-12 PFAM
Pfam:Reprolysin 383 474 3.1e-9 PFAM
DISIN 484 561 6.27e-26 SMART
PDB:2M2F|A 581 642 4e-32 PDB
transmembrane domain 672 694 N/A INTRINSIC
low complexity region 739 755 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101551
AA Change: R177C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099087
Gene: ENSMUSG00000052593
AA Change: R177C

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 31 167 9.7e-15 PFAM
Pfam:Reprolysin_5 221 470 5e-34 PFAM
Pfam:Reprolysin_4 221 488 6.1e-20 PFAM
Pfam:Reprolysin_2 264 483 2.6e-34 PFAM
Pfam:Reprolysin_3 267 435 2.8e-14 PFAM
Pfam:Reprolysin 330 493 5.3e-9 PFAM
DISIN 503 580 6.27e-26 SMART
Pfam:ADAM17_MPD 600 661 1e-23 PFAM
transmembrane domain 691 713 N/A INTRINSIC
low complexity region 758 774 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000127974
AA Change: R177C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136677
Gene: ENSMUSG00000052593
AA Change: R177C

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 25 167 9.1e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142092
SMART Domains Protein: ENSMUSP00000136255
Gene: ENSMUSG00000052593

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 35 47 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000145118
AA Change: R177C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136407
Gene: ENSMUSG00000052593
AA Change: R177C

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 28 167 7.5e-12 PFAM
Pfam:Reprolysin_5 221 451 4.2e-37 PFAM
Pfam:Reprolysin_4 221 469 2e-24 PFAM
Pfam:Reprolysin_2 244 464 5.6e-29 PFAM
Pfam:Reprolysin_3 248 416 7.8e-13 PFAM
Pfam:Reprolysin 381 474 2.2e-9 PFAM
DISIN 484 561 6.27e-26 SMART
PDB:2M2F|A 581 638 5e-29 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158372
Predicted Effect probably benign
Transcript: ENSMUST00000232107
Predicted Effect probably benign
Transcript: ENSMUST00000232526
Meta Mutation Damage Score 0.6201 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.6%
Validation Efficiency 99% (87/88)
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. The encoded preproprotein undergoes proteolytic processing to generate a mature enzyme that is involved in the proteolytic release of membrane-bound proteins in a process called ectodomain shedding. Mice lacking the encoded protein die in utero or fail to survive beyond one week of age. Alternative splicing results in multiple transcript variants encoding different isoforms, some of which may undergo similar processing. [provided by RefSeq, May 2016]
PHENOTYPE: Most mice homozygous for targeted mutations that inactivate the gene die perinatally with stunted vibrissae and open eyelids. Survivors display various degrees of eye degeneration, perturbed hair coats, curly vibrissae, and irregular pigmentation patterns. Histological analysis of fetuses reveal defects in epithelial cell maturation and organization in multiple organs. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted, knock-out(2) Targeted, other(3) Gene trapped(8)

Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012P17Rik C A 1: 158,968,912 noncoding transcript Het
9530053A07Rik T C 7: 28,155,594 S1882P probably benign Het
Ak7 G A 12: 105,745,332 probably null Het
Akap9 T C 5: 3,961,967 V890A probably damaging Het
Alg6 A G 4: 99,738,132 N59S probably damaging Het
Alkbh5 G T 11: 60,538,549 A43S probably benign Het
Anxa2 C A 9: 69,483,817 D162E probably damaging Het
Arap1 A G 7: 101,401,518 H1136R probably benign Het
Arhgap18 A G 10: 26,854,904 R121G probably benign Het
Arhgef4 A T 1: 34,723,810 T716S unknown Het
Atg2a T C 19: 6,250,269 probably null Het
Ccdc27 T C 4: 154,033,313 I480V probably null Het
Cdipt T C 7: 126,976,933 V20A possibly damaging Het
Cgrrf1 C T 14: 46,830,445 probably benign Het
Chd7 G A 4: 8,855,226 V2152I probably benign Het
Chd8 T A 14: 52,215,241 S1274C probably damaging Het
Chuk A T 19: 44,107,343 M17K possibly damaging Het
Col14a1 C T 15: 55,446,181 probably benign Het
Col20a1 G A 2: 181,013,163 probably null Het
Cped1 A G 6: 22,143,964 I570V probably benign Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Ddx27 A C 2: 167,033,771 Q674P probably damaging Het
Dennd6a T A 14: 26,612,003 F131L probably damaging Het
Dhx38 G A 8: 109,556,869 probably benign Het
Dido1 G T 2: 180,659,585 N2175K unknown Het
Dmxl1 T A 18: 49,889,558 Y1654* probably null Het
Dock7 T A 4: 98,959,101 H1658L probably damaging Het
Dync2h1 T A 9: 7,122,772 E2061D probably damaging Het
Dync2h1 T C 9: 7,162,925 I555V probably benign Het
Eif2ak2 T C 17: 78,863,963 E337G possibly damaging Het
Fabp12 T A 3: 10,250,149 D46V probably benign Het
Fech C T 18: 64,478,727 E79K probably damaging Het
Flnc A T 6: 29,444,363 I693F probably damaging Het
Foxp2 G A 6: 15,324,644 C97Y possibly damaging Het
Grin2b A G 6: 135,733,896 M884T probably benign Het
Gtf2ird1 T C 5: 134,417,093 D28G probably damaging Het
Gtf3c4 C A 2: 28,833,894 G468W possibly damaging Het
Ift172 A T 5: 31,267,241 L201* probably null Het
Il1rl2 C A 1: 40,365,214 S498R probably damaging Het
Ildr1 C T 16: 36,725,541 R489W probably damaging Het
Itga10 G A 3: 96,652,490 G487D probably damaging Het
Klk8 A G 7: 43,799,216 N128D probably benign Het
Lgr6 G A 1: 135,075,275 T79M probably damaging Het
Med6 T C 12: 81,573,877 T232A probably benign Het
Mgat4e A G 1: 134,541,322 L328P probably damaging Het
Mttp A G 3: 138,118,402 Y138H probably damaging Het
Ngef T C 1: 87,545,968 R31G probably benign Het
Nipsnap2 C A 5: 129,753,223 probably null Het
Nlgn2 G T 11: 69,828,441 N194K probably damaging Het
Olfr1026 A G 2: 85,923,743 I158M probably benign Het
Olfr1245 A T 2: 89,574,961 M255K possibly damaging Het
Olfr1450 G A 19: 12,954,332 V248I possibly damaging Het
Olfr357 G A 2: 36,997,652 V281M possibly damaging Het
Olfr894 A G 9: 38,219,432 Y203C possibly damaging Het
Pcca T A 14: 122,813,222 M101K possibly damaging Het
Plekha6 A G 1: 133,284,970 T671A possibly damaging Het
Prex2 G A 1: 11,162,312 V868M probably damaging Het
Prkcq G A 2: 11,279,521 V501I probably benign Het
Prom1 T A 5: 44,011,253 probably benign Het
Ptprd A G 4: 76,133,161 V41A probably damaging Het
Rab39 C T 9: 53,686,398 G189E possibly damaging Het
Ret T C 6: 118,180,382 K236E possibly damaging Het
Rfx6 G A 10: 51,720,057 probably null Het
Rnf213 A G 11: 119,461,918 T3916A probably damaging Het
Rpn1 A G 6: 88,095,683 N336S probably damaging Het
Sag G A 1: 87,805,315 A2T probably damaging Het
Sco2 T C 15: 89,371,860 Y197C probably damaging Het
Sec23b T C 2: 144,566,944 I183T possibly damaging Het
Sec24b C T 3: 129,987,728 V1166M probably damaging Het
Slc27a5 A T 7: 12,993,412 F361Y probably damaging Het
Spaca9 A G 2: 28,696,001 L17P probably damaging Het
Sqor T C 2: 122,804,107 probably null Het
Stx18 A G 5: 38,135,244 H230R probably damaging Het
Tas2r130 A T 6: 131,630,769 I21N probably damaging Het
Tcaf3 A G 6: 42,593,724 S365P possibly damaging Het
Tinagl1 G A 4: 130,166,972 H351Y probably damaging Het
Tmc2 T C 2: 130,232,385 Y333H probably damaging Het
Trp53bp2 A T 1: 182,442,819 T395S probably damaging Het
Tsc22d1 T C 14: 76,418,333 S751P probably damaging Het
Ttc30a1 A G 2: 75,980,935 V268A probably benign Het
Ttn A G 2: 76,827,024 probably benign Het
Ugdh T C 5: 65,416,925 Y425C probably damaging Het
Vmn1r115 G A 7: 20,844,169 L273F probably null Het
Vmn2r109 A T 17: 20,541,186 C636* probably null Het
Vmn2r59 A C 7: 42,043,779 Y466D probably damaging Het
Zic5 C T 14: 122,464,830 G163D unknown Het
Other mutations in Adam17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00555:Adam17 APN 12 21328109 missense probably damaging 1.00
IGL01340:Adam17 APN 12 21330057 nonsense probably null
IGL01973:Adam17 APN 12 21349943 missense probably damaging 1.00
IGL02223:Adam17 APN 12 21361705 missense possibly damaging 0.92
IGL03153:Adam17 APN 12 21345697 missense probably damaging 1.00
Steinway UTSW 12 21353948 missense probably damaging 1.00
wavedx UTSW 12 21340750 missense probably damaging 1.00
R0014:Adam17 UTSW 12 21336644 missense probably benign 0.36
R0080:Adam17 UTSW 12 21329048 splice site probably benign
R0082:Adam17 UTSW 12 21329048 splice site probably benign
R0324:Adam17 UTSW 12 21349938 missense probably benign 0.00
R0511:Adam17 UTSW 12 21340458 splice site probably benign
R0745:Adam17 UTSW 12 21332221 splice site probably benign
R1314:Adam17 UTSW 12 21329071 missense probably damaging 1.00
R1547:Adam17 UTSW 12 21353957 missense probably damaging 1.00
R1594:Adam17 UTSW 12 21340470 critical splice donor site probably null
R1607:Adam17 UTSW 12 21334138 splice site probably null
R1812:Adam17 UTSW 12 21361767 missense probably damaging 0.97
R3408:Adam17 UTSW 12 21329118 missense probably damaging 1.00
R3735:Adam17 UTSW 12 21325412 missense probably benign 0.05
R3886:Adam17 UTSW 12 21325587 missense probably damaging 1.00
R3888:Adam17 UTSW 12 21325587 missense probably damaging 1.00
R4062:Adam17 UTSW 12 21325457 missense probably damaging 1.00
R4415:Adam17 UTSW 12 21345701 missense possibly damaging 0.90
R4563:Adam17 UTSW 12 21332088 missense probably damaging 1.00
R4658:Adam17 UTSW 12 21332160 missense probably damaging 1.00
R4763:Adam17 UTSW 12 21334015 missense probably benign
R4793:Adam17 UTSW 12 21347395 missense probably benign
R5101:Adam17 UTSW 12 21373405 missense possibly damaging 0.85
R5120:Adam17 UTSW 12 21343019 intron probably benign
R5514:Adam17 UTSW 12 21340519 missense probably damaging 0.98
R5592:Adam17 UTSW 12 21334137 missense probably damaging 1.00
R5874:Adam17 UTSW 12 21329086 missense possibly damaging 0.76
R6110:Adam17 UTSW 12 21353948 missense probably damaging 1.00
R6451:Adam17 UTSW 12 21342882 missense probably benign 0.00
R6930:Adam17 UTSW 12 21353948 missense probably damaging 1.00
R6970:Adam17 UTSW 12 21345668 missense probably benign 0.06
R7213:Adam17 UTSW 12 21336678 nonsense probably null
R7302:Adam17 UTSW 12 21355693 intron probably benign
R7361:Adam17 UTSW 12 21325601 missense probably damaging 0.98
R7667:Adam17 UTSW 12 21333952 critical splice donor site probably null
R7799:Adam17 UTSW 12 21340492 missense probably damaging 1.00
R8762:Adam17 UTSW 12 21351594 missense probably benign 0.03
X0063:Adam17 UTSW 12 21332585 missense probably benign 0.17
Z1176:Adam17 UTSW 12 21361737 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CTGTAACAAAACTGTATTTTCAGACCA -3'
(R):5'- AGAAACTGTAAGATTAAACAAGCACT -3'

Sequencing Primer
(F):5'- GTTCGATTCCCAGTAACCACATGATG -3'
(R):5'- CCAAGAACAAAGAATGTTGTG -3'
Posted On2014-08-25