Mutagenetix > Incidental Mutation

Incidental Mutation 'R2020:Tsc22d1'

223881

Institutional Source

Beutler Lab

Gene Symbol

Tsc22d1

Ensembl Gene

ENSMUSG00000022010

Gene Name

TSC22 domain family, member 1

Synonyms

TSC-22, Tgfb1i4, Egr5

MMRRC Submission

040029-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.259) question?

Stock #

R2020 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

76414961-76507765 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 76418333 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 751 (S751P)

Ref Sequence

ENSEMBL: ENSMUSP00000044517 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048371] [ENSMUST00000110888] [ENSMUST00000175984] [ENSMUST00000176581] [ENSMUST00000176886] [ENSMUST00000177471]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000048371
AA Change: S751P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000044517
Gene: ENSMUSG00000022010
AA Change: S751P

Domain	Start	End	E-Value	Type
low complexity region	32	47	N/A	INTRINSIC
low complexity region	59	96	N/A	INTRINSIC
low complexity region	121	132	N/A	INTRINSIC
low complexity region	191	208	N/A	INTRINSIC
low complexity region	216	241	N/A	INTRINSIC
low complexity region	246	257	N/A	INTRINSIC
low complexity region	266	289	N/A	INTRINSIC
low complexity region	461	489	N/A	INTRINSIC
low complexity region	497	521	N/A	INTRINSIC
low complexity region	537	556	N/A	INTRINSIC
low complexity region	619	637	N/A	INTRINSIC
low complexity region	673	687	N/A	INTRINSIC
low complexity region	702	724	N/A	INTRINSIC
low complexity region	933	970	N/A	INTRINSIC
Pfam:TSC22	992	1048	7e-31	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000110888
AA Change: S669P

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000106513
Gene: ENSMUSG00000022010
AA Change: S669P

Domain	Start	End	E-Value	Type
low complexity region	32	47	N/A	INTRINSIC
low complexity region	59	96	N/A	INTRINSIC
low complexity region	121	132	N/A	INTRINSIC
low complexity region	191	208	N/A	INTRINSIC
low complexity region	216	241	N/A	INTRINSIC
low complexity region	246	257	N/A	INTRINSIC
low complexity region	266	289	N/A	INTRINSIC
low complexity region	379	407	N/A	INTRINSIC
low complexity region	415	439	N/A	INTRINSIC
low complexity region	455	474	N/A	INTRINSIC
internal_repeat_1	502	536	8.43e-5	PROSPERO
low complexity region	537	555	N/A	INTRINSIC
low complexity region	591	605	N/A	INTRINSIC
low complexity region	620	642	N/A	INTRINSIC
internal_repeat_1	644	676	8.43e-5	PROSPERO
low complexity region	851	888	N/A	INTRINSIC
Pfam:TSC22	910	969	4.7e-34	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000175984

SMART Domains

Protein: ENSMUSP00000135307
Gene: ENSMUSG00000022010

Domain	Start	End	E-Value	Type
low complexity region	77	114	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000176581

SMART Domains

Protein: ENSMUSP00000135789
Gene: ENSMUSG00000022010

Domain	Start	End	E-Value	Type
low complexity region	78	115	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000176886

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177333

Predicted Effect

probably benign
Transcript: ENSMUST00000177471

SMART Domains

Protein: ENSMUSP00000134792
Gene: ENSMUSG00000022010

Domain	Start	End	E-Value	Type
low complexity region	18	55	N/A	INTRINSIC

Meta Mutation Damage Score

0.0607

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 93.6%

Validation Efficiency

99% (87/88)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the TSC22 domain family of leucine zipper transcription factors. The encoded protein is stimulated by transforming growth factor beta, and regulates the transcription of multiple genes including C-type natriuretic peptide. The encoded protein may play a critical role in tumor suppression through the induction of cancer cell apoptosis, and a single nucleotide polymorphism in the promoter of this gene has been associated with diabetic nephropathy. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mcie homozygous for a null allele exhibit increased proliferation of bone marrow cells and decreased kidney and heart weights. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600012P17Rik	C	A	1: 158,968,912		noncoding transcript	Het
9530053A07Rik	T	C	7: 28,155,594	S1882P	probably benign	Het
Adam17	G	A	12: 21,349,875	R177C	probably damaging	Het
Ak7	G	A	12: 105,745,332		probably null	Het
Akap9	T	C	5: 3,961,967	V890A	probably damaging	Het
Alg6	A	G	4: 99,738,132	N59S	probably damaging	Het
Alkbh5	G	T	11: 60,538,549	A43S	probably benign	Het
Anxa2	C	A	9: 69,483,817	D162E	probably damaging	Het
Arap1	A	G	7: 101,401,518	H1136R	probably benign	Het
Arhgap18	A	G	10: 26,854,904	R121G	probably benign	Het
Arhgef4	A	T	1: 34,723,810	T716S	unknown	Het
Atg2a	T	C	19: 6,250,269		probably null	Het
Ccdc27	T	C	4: 154,033,313	I480V	probably null	Het
Cdipt	T	C	7: 126,976,933	V20A	possibly damaging	Het
Cgrrf1	C	T	14: 46,830,445		probably benign	Het
Chd7	G	A	4: 8,855,226	V2152I	probably benign	Het
Chd8	T	A	14: 52,215,241	S1274C	probably damaging	Het
Chuk	A	T	19: 44,107,343	M17K	possibly damaging	Het
Col14a1	C	T	15: 55,446,181		probably benign	Het
Col20a1	G	A	2: 181,013,163		probably null	Het
Cped1	A	G	6: 22,143,964	I570V	probably benign	Het
Cul9	C	G	17: 46,522,175	A1326P	probably damaging	Het
Ddx27	A	C	2: 167,033,771	Q674P	probably damaging	Het
Dennd6a	T	A	14: 26,612,003	F131L	probably damaging	Het
Dhx38	G	A	8: 109,556,869		probably benign	Het
Dido1	G	T	2: 180,659,585	N2175K	unknown	Het
Dmxl1	T	A	18: 49,889,558	Y1654*	probably null	Het
Dock7	T	A	4: 98,959,101	H1658L	probably damaging	Het
Dync2h1	T	A	9: 7,122,772	E2061D	probably damaging	Het
Dync2h1	T	C	9: 7,162,925	I555V	probably benign	Het
Eif2ak2	T	C	17: 78,863,963	E337G	possibly damaging	Het
Fabp12	T	A	3: 10,250,149	D46V	probably benign	Het
Fech	C	T	18: 64,478,727	E79K	probably damaging	Het
Flnc	A	T	6: 29,444,363	I693F	probably damaging	Het
Foxp2	G	A	6: 15,324,644	C97Y	possibly damaging	Het
Grin2b	A	G	6: 135,733,896	M884T	probably benign	Het
Gtf2ird1	T	C	5: 134,417,093	D28G	probably damaging	Het
Gtf3c4	C	A	2: 28,833,894	G468W	possibly damaging	Het
Ift172	A	T	5: 31,267,241	L201*	probably null	Het
Il1rl2	C	A	1: 40,365,214	S498R	probably damaging	Het
Ildr1	C	T	16: 36,725,541	R489W	probably damaging	Het
Itga10	G	A	3: 96,652,490	G487D	probably damaging	Het
Klk8	A	G	7: 43,799,216	N128D	probably benign	Het
Lgr6	G	A	1: 135,075,275	T79M	probably damaging	Het
Med6	T	C	12: 81,573,877	T232A	probably benign	Het
Mgat4e	A	G	1: 134,541,322	L328P	probably damaging	Het
Mttp	A	G	3: 138,118,402	Y138H	probably damaging	Het
Ngef	T	C	1: 87,545,968	R31G	probably benign	Het
Nipsnap2	C	A	5: 129,753,223		probably null	Het
Nlgn2	G	T	11: 69,828,441	N194K	probably damaging	Het
Olfr1026	A	G	2: 85,923,743	I158M	probably benign	Het
Olfr1245	A	T	2: 89,574,961	M255K	possibly damaging	Het
Olfr1450	G	A	19: 12,954,332	V248I	possibly damaging	Het
Olfr357	G	A	2: 36,997,652	V281M	possibly damaging	Het
Olfr894	A	G	9: 38,219,432	Y203C	possibly damaging	Het
Pcca	T	A	14: 122,813,222	M101K	possibly damaging	Het
Plekha6	A	G	1: 133,284,970	T671A	possibly damaging	Het
Prex2	G	A	1: 11,162,312	V868M	probably damaging	Het
Prkcq	G	A	2: 11,279,521	V501I	probably benign	Het
Prom1	T	A	5: 44,011,253		probably benign	Het
Ptprd	A	G	4: 76,133,161	V41A	probably damaging	Het
Rab39	C	T	9: 53,686,398	G189E	possibly damaging	Het
Ret	T	C	6: 118,180,382	K236E	possibly damaging	Het
Rfx6	G	A	10: 51,720,057		probably null	Het
Rnf213	A	G	11: 119,461,918	T3916A	probably damaging	Het
Rpn1	A	G	6: 88,095,683	N336S	probably damaging	Het
Sag	G	A	1: 87,805,315	A2T	probably damaging	Het
Sco2	T	C	15: 89,371,860	Y197C	probably damaging	Het
Sec23b	T	C	2: 144,566,944	I183T	possibly damaging	Het
Sec24b	C	T	3: 129,987,728	V1166M	probably damaging	Het
Slc27a5	A	T	7: 12,993,412	F361Y	probably damaging	Het
Spaca9	A	G	2: 28,696,001	L17P	probably damaging	Het
Sqor	T	C	2: 122,804,107		probably null	Het
Stx18	A	G	5: 38,135,244	H230R	probably damaging	Het
Tas2r130	A	T	6: 131,630,769	I21N	probably damaging	Het
Tcaf3	A	G	6: 42,593,724	S365P	possibly damaging	Het
Tinagl1	G	A	4: 130,166,972	H351Y	probably damaging	Het
Tmc2	T	C	2: 130,232,385	Y333H	probably damaging	Het
Trp53bp2	A	T	1: 182,442,819	T395S	probably damaging	Het
Ttc30a1	A	G	2: 75,980,935	V268A	probably benign	Het
Ttn	A	G	2: 76,827,024		probably benign	Het
Ugdh	T	C	5: 65,416,925	Y425C	probably damaging	Het
Vmn1r115	G	A	7: 20,844,169	L273F	probably null	Het
Vmn2r109	A	T	17: 20,541,186	C636*	probably null	Het
Vmn2r59	A	C	7: 42,043,779	Y466D	probably damaging	Het
Zic5	C	T	14: 122,464,830	G163D	unknown	Het

Other mutations in Tsc22d1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00499:Tsc22d1	APN	14	76418917	missense	probably damaging	0.99
IGL00515:Tsc22d1	APN	14	76418477	missense	probably damaging	0.99
IGL00703:Tsc22d1	APN	14	76504828	missense	possibly damaging	0.62
IGL00974:Tsc22d1	APN	14	76506442	missense	probably damaging	1.00
IGL01015:Tsc22d1	APN	14	76418741	missense	possibly damaging	0.66
IGL01515:Tsc22d1	APN	14	76505299	critical splice donor site	probably null
IGL02172:Tsc22d1	APN	14	76417692	missense	probably benign	0.04
IGL02307:Tsc22d1	APN	14	76416461	missense	probably damaging	0.99
IGL02553:Tsc22d1	APN	14	76417398	missense	possibly damaging	0.73
IGL02870:Tsc22d1	APN	14	76417617	missense	probably benign	0.42
IGL02989:Tsc22d1	APN	14	76418901	missense	probably benign	0.05
IGL03216:Tsc22d1	APN	14	76418637	missense	probably benign	0.02
R0127:Tsc22d1	UTSW	14	76418981	missense	possibly damaging	0.92
R0416:Tsc22d1	UTSW	14	76505303	splice site	probably benign
R0854:Tsc22d1	UTSW	14	76418201	nonsense	probably null
R0963:Tsc22d1	UTSW	14	76418599	missense	possibly damaging	0.92
R1370:Tsc22d1	UTSW	14	76437664	intron	probably benign
R1736:Tsc22d1	UTSW	14	76418357	missense	probably benign	0.08
R1751:Tsc22d1	UTSW	14	76418102	missense	probably damaging	0.98
R1760:Tsc22d1	UTSW	14	76416948	missense	possibly damaging	0.69
R1767:Tsc22d1	UTSW	14	76418102	missense	probably damaging	0.98
R2209:Tsc22d1	UTSW	14	76418740	missense	probably damaging	1.00
R2439:Tsc22d1	UTSW	14	76417267	unclassified	probably benign
R2471:Tsc22d1	UTSW	14	76418204	missense	probably benign	0.00
R3114:Tsc22d1	UTSW	14	76417337	missense	probably damaging	1.00
R3907:Tsc22d1	UTSW	14	76416543	missense	probably damaging	0.98
R3973:Tsc22d1	UTSW	14	76418609	missense	probably damaging	1.00
R3974:Tsc22d1	UTSW	14	76418609	missense	probably damaging	1.00
R3975:Tsc22d1	UTSW	14	76418609	missense	probably damaging	1.00
R3976:Tsc22d1	UTSW	14	76418609	missense	probably damaging	1.00
R4292:Tsc22d1	UTSW	14	76418880	missense	probably benign	0.12
R4612:Tsc22d1	UTSW	14	76419005	missense	possibly damaging	0.66
R4806:Tsc22d1	UTSW	14	76416988	splice site	probably null
R4980:Tsc22d1	UTSW	14	76418256	missense	probably benign	0.02
R5068:Tsc22d1	UTSW	14	76418310	missense	probably benign	0.44
R5070:Tsc22d1	UTSW	14	76418310	missense	probably benign	0.44
R5239:Tsc22d1	UTSW	14	76418412	missense	probably damaging	0.99
R5360:Tsc22d1	UTSW	14	76417267	unclassified	probably benign
R5400:Tsc22d1	UTSW	14	76417054	missense	probably benign	0.00
R5616:Tsc22d1	UTSW	14	76416217	unclassified	probably benign
R5726:Tsc22d1	UTSW	14	76505317	nonsense	probably null
R5934:Tsc22d1	UTSW	14	76418826	missense	possibly damaging	0.87
R6860:Tsc22d1	UTSW	14	76418292	missense	possibly damaging	0.73
R6904:Tsc22d1	UTSW	14	76506483	nonsense	probably null
R7016:Tsc22d1	UTSW	14	76417542	missense	probably damaging	1.00
R7274:Tsc22d1	UTSW	14	76416714	missense	probably damaging	0.98
R7482:Tsc22d1	UTSW	14	76418487	missense	probably benign	0.10
R7532:Tsc22d1	UTSW	14	76416046	unclassified	probably benign
R7536:Tsc22d1	UTSW	14	76504763	missense	probably benign	0.00
R7784:Tsc22d1	UTSW	14	76416701	nonsense	probably null
R8161:Tsc22d1	UTSW	14	76417020	missense	probably benign	0.02
R8405:Tsc22d1	UTSW	14	76418294	missense	probably damaging	1.00
R8963:Tsc22d1	UTSW	14	76418826	missense	probably benign	0.06
R9150:Tsc22d1	UTSW	14	76416616	missense	probably damaging	0.99
R9259:Tsc22d1	UTSW	14	76417044	missense	probably damaging	1.00
R9431:Tsc22d1	UTSW	14	76417267	unclassified	probably benign
R9439:Tsc22d1	UTSW	14	76506459	missense	probably damaging	0.99
R9614:Tsc22d1	UTSW	14	76416543	missense	probably damaging	0.98
R9708:Tsc22d1	UTSW	14	76417224	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- TCAGTGATTCCTGTGGCTCAG -3'
(R):5'- GCAACTGCTGGGAAACAACC -3'

Sequencing Primer
(F):5'- TCAGGCACAGGGGATCCAG -3'
(R):5'- GGGCCACGGTTTCTACTC -3'

Posted On

2014-08-25