Mutagenetix > Incidental Mutations

Incidental Mutation 'R2020:Ildr1'

223889

Institutional Source

Beutler Lab

Gene Symbol

Ildr1

Ensembl Gene

ENSMUSG00000022900

Gene Name

immunoglobulin-like domain containing receptor 1

Synonyms

MMRRC Submission

040029-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2020 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

36693978-36726804 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 36725541 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Tryptophan at position 489 (R489W)

Ref Sequence

ENSEMBL: ENSMUSP00000087045 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023617] [ENSMUST00000089618] [ENSMUST00000119464]

Predicted Effect

probably damaging
Transcript: ENSMUST00000023617
AA Change: R533W

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000023617
Gene: ENSMUSG00000022900
AA Change: R533W

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
IG	29	165	2.34e-4	SMART
Pfam:LSR	166	213	3e-27	PFAM
low complexity region	255	268	N/A	INTRINSIC
low complexity region	424	472	N/A	INTRINSIC
low complexity region	481	489	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000089618
AA Change: R489W

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000087045
Gene: ENSMUSG00000022900
AA Change: R489W

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
IG	29	165	2.34e-4	SMART
Pfam:LSR	166	214	2.8e-27	PFAM
low complexity region	380	428	N/A	INTRINSIC
low complexity region	437	445	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000119464

SMART Domains

Protein: ENSMUSP00000112539
Gene: ENSMUSG00000022900

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
IG	29	165	2.34e-4	SMART
Pfam:LSR	166	214	3e-27	PFAM
low complexity region	255	268	N/A	INTRINSIC
low complexity region	424	472	N/A	INTRINSIC
low complexity region	481	489	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128084

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 93.6%

Validation Efficiency

99% (87/88)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains an immunoglobulin-like domain. The encoded protein may function as a multimeric receptor at the cell surface. The expression of this gene may be a diagnostic marker for cancer progression. Alternatively spliced transcript variants encoding multiple protein isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygous inactivation of this gene leads to progressive cochlear hair cell degeneration and profound deafness. Mice homozygous for a gene trap allele also exhibit impaired lipid-induced cholecystokinin secretion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600012P17Rik	C	A	1: 158,968,912		noncoding transcript	Het
9530053A07Rik	T	C	7: 28,155,594	S1882P	probably benign	Het
Adam17	G	A	12: 21,349,875	R177C	probably damaging	Het
Ak7	G	A	12: 105,745,332		probably null	Het
Akap9	T	C	5: 3,961,967	V890A	probably damaging	Het
Alg6	A	G	4: 99,738,132	N59S	probably damaging	Het
Alkbh5	G	T	11: 60,538,549	A43S	probably benign	Het
Anxa2	C	A	9: 69,483,817	D162E	probably damaging	Het
Arap1	A	G	7: 101,401,518	H1136R	probably benign	Het
Arhgap18	A	G	10: 26,854,904	R121G	probably benign	Het
Arhgef4	A	T	1: 34,723,810	T716S	unknown	Het
Atg2a	T	C	19: 6,250,269		probably null	Het
Ccdc27	T	C	4: 154,033,313	I480V	probably null	Het
Cdipt	T	C	7: 126,976,933	V20A	possibly damaging	Het
Cgrrf1	C	T	14: 46,830,445		probably benign	Het
Chd7	G	A	4: 8,855,226	V2152I	probably benign	Het
Chd8	T	A	14: 52,215,241	S1274C	probably damaging	Het
Chuk	A	T	19: 44,107,343	M17K	possibly damaging	Het
Col14a1	C	T	15: 55,446,181		probably benign	Het
Col20a1	G	A	2: 181,013,163		probably null	Het
Cped1	A	G	6: 22,143,964	I570V	probably benign	Het
Cul9	C	G	17: 46,522,175	A1326P	probably damaging	Het
Ddx27	A	C	2: 167,033,771	Q674P	probably damaging	Het
Dennd6a	T	A	14: 26,612,003	F131L	probably damaging	Het
Dhx38	G	A	8: 109,556,869		probably benign	Het
Dido1	G	T	2: 180,659,585	N2175K	unknown	Het
Dmxl1	T	A	18: 49,889,558	Y1654*	probably null	Het
Dock7	T	A	4: 98,959,101	H1658L	probably damaging	Het
Dync2h1	T	C	9: 7,162,925	I555V	probably benign	Het
Dync2h1	T	A	9: 7,122,772	E2061D	probably damaging	Het
Eif2ak2	T	C	17: 78,863,963	E337G	possibly damaging	Het
Fabp12	T	A	3: 10,250,149	D46V	probably benign	Het
Fech	C	T	18: 64,478,727	E79K	probably damaging	Het
Flnc	A	T	6: 29,444,363	I693F	probably damaging	Het
Foxp2	G	A	6: 15,324,644	C97Y	possibly damaging	Het
Grin2b	A	G	6: 135,733,896	M884T	probably benign	Het
Gtf2ird1	T	C	5: 134,417,093	D28G	probably damaging	Het
Gtf3c4	C	A	2: 28,833,894	G468W	possibly damaging	Het
Ift172	A	T	5: 31,267,241	L201*	probably null	Het
Il1rl2	C	A	1: 40,365,214	S498R	probably damaging	Het
Itga10	G	A	3: 96,652,490	G487D	probably damaging	Het
Klk8	A	G	7: 43,799,216	N128D	probably benign	Het
Lgr6	G	A	1: 135,075,275	T79M	probably damaging	Het
Med6	T	C	12: 81,573,877	T232A	probably benign	Het
Mgat4e	A	G	1: 134,541,322	L328P	probably damaging	Het
Mttp	A	G	3: 138,118,402	Y138H	probably damaging	Het
Ngef	T	C	1: 87,545,968	R31G	probably benign	Het
Nipsnap2	C	A	5: 129,753,223		probably null	Het
Nlgn2	G	T	11: 69,828,441	N194K	probably damaging	Het
Olfr1026	A	G	2: 85,923,743	I158M	probably benign	Het
Olfr1245	A	T	2: 89,574,961	M255K	possibly damaging	Het
Olfr1450	G	A	19: 12,954,332	V248I	possibly damaging	Het
Olfr357	G	A	2: 36,997,652	V281M	possibly damaging	Het
Olfr894	A	G	9: 38,219,432	Y203C	possibly damaging	Het
Pcca	T	A	14: 122,813,222	M101K	possibly damaging	Het
Plekha6	A	G	1: 133,284,970	T671A	possibly damaging	Het
Prex2	G	A	1: 11,162,312	V868M	probably damaging	Het
Prkcq	G	A	2: 11,279,521	V501I	probably benign	Het
Prom1	T	A	5: 44,011,253		probably benign	Het
Ptprd	A	G	4: 76,133,161	V41A	probably damaging	Het
Rab39	C	T	9: 53,686,398	G189E	possibly damaging	Het
Ret	T	C	6: 118,180,382	K236E	possibly damaging	Het
Rfx6	G	A	10: 51,720,057		probably null	Het
Rnf213	A	G	11: 119,461,918	T3916A	probably damaging	Het
Rpn1	A	G	6: 88,095,683	N336S	probably damaging	Het
Sag	G	A	1: 87,805,315	A2T	probably damaging	Het
Sco2	T	C	15: 89,371,860	Y197C	probably damaging	Het
Sec23b	T	C	2: 144,566,944	I183T	possibly damaging	Het
Sec24b	C	T	3: 129,987,728	V1166M	probably damaging	Het
Slc27a5	A	T	7: 12,993,412	F361Y	probably damaging	Het
Spaca9	A	G	2: 28,696,001	L17P	probably damaging	Het
Sqor	T	C	2: 122,804,107		probably null	Het
Stx18	A	G	5: 38,135,244	H230R	probably damaging	Het
Tas2r130	A	T	6: 131,630,769	I21N	probably damaging	Het
Tcaf3	A	G	6: 42,593,724	S365P	possibly damaging	Het
Tinagl1	G	A	4: 130,166,972	H351Y	probably damaging	Het
Tmc2	T	C	2: 130,232,385	Y333H	probably damaging	Het
Trp53bp2	A	T	1: 182,442,819	T395S	probably damaging	Het
Tsc22d1	T	C	14: 76,418,333	S751P	probably damaging	Het
Ttc30a1	A	G	2: 75,980,935	V268A	probably benign	Het
Ttn	A	G	2: 76,827,024		probably benign	Het
Ugdh	T	C	5: 65,416,925	Y425C	probably damaging	Het
Vmn1r115	G	A	7: 20,844,169	L273F	probably null	Het
Vmn2r109	A	T	17: 20,541,186	C636*	probably null	Het
Vmn2r59	A	C	7: 42,043,779	Y466D	probably damaging	Het
Zic5	C	T	14: 122,464,830	G163D	unknown	Het

Other mutations in Ildr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02501:Ildr1	APN	16	36722350	missense	probably damaging	1.00
IGL02505:Ildr1	APN	16	36716164	missense	probably damaging	1.00
R0295:Ildr1	UTSW	16	36709477	critical splice acceptor site	probably null
R1649:Ildr1	UTSW	16	36708319	missense	probably damaging	1.00
R1728:Ildr1	UTSW	16	36708336	missense	possibly damaging	0.80
R1990:Ildr1	UTSW	16	36716206	missense	probably damaging	0.99
R2110:Ildr1	UTSW	16	36721979	missense	probably damaging	1.00
R2111:Ildr1	UTSW	16	36721979	missense	probably damaging	1.00
R4755:Ildr1	UTSW	16	36722021	missense	probably benign	0.00
R4798:Ildr1	UTSW	16	36722555	missense	possibly damaging	0.66
R4973:Ildr1	UTSW	16	36708298	missense	probably benign	0.10
R5014:Ildr1	UTSW	16	36721559	missense	probably damaging	0.98
R5426:Ildr1	UTSW	16	36709619	missense	probably damaging	1.00
R5957:Ildr1	UTSW	16	36725534	makesense	probably null
R7058:Ildr1	UTSW	16	36722368	missense	probably benign	0.01
R7646:Ildr1	UTSW	16	36721919	missense	possibly damaging	0.78

Predicted Primers

PCR Primer
(F):5'- TCCACAGTGTTGGAGGAAGG -3'
(R):5'- GGAGCCCTTACAAGTCAGAG -3'

Sequencing Primer
(F):5'- CAGTGTTGGAGGAAGGCCATTG -3'
(R):5'- GGGGGAAAGCTTGCTATTAATTCCAC -3'

Posted On

2014-08-25