Incidental Mutation 'R2020:Eif2ak2'
ID 223897
Institutional Source Beutler Lab
Gene Symbol Eif2ak2
Ensembl Gene ENSMUSG00000024079
Gene Name eukaryotic translation initiation factor 2-alpha kinase 2
Synonyms dsRNA-activated kinase, eIF-2 alpha, eIF-2 alpha, IFN- type I-induced and dsRNA-activated kinase, IFN-induced and double-stranded RNA-activated kinase, Pkr, Prkr, Tik
MMRRC Submission 040029-MU
Accession Numbers

Genbank: NM_011163; MGI: 1353449
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2020 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 78852564-78882573 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 78863963 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 337 (E337G)
Ref Sequence ENSEMBL: ENSMUSP00000024884 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024884]
AlphaFold Q03963
PDB Structure Solution structure of the second DSRM domain in Interferon-induced, double-stranded RNA-activated protein kinase [SOLUTION NMR]
Solution structure of the first DSRM domain in Interferon-induced, double-stranded RNA-activated protein kinase [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024884
AA Change: E337G

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000024884
Gene: ENSMUSG00000024079
AA Change: E337G

DomainStartEndE-ValueType
DSRM 9 75 2.34e-20 SMART
DSRM 96 161 7.66e-16 SMART
low complexity region 169 196 N/A INTRINSIC
Pfam:Pkinase 242 500 4.6e-56 PFAM
Pfam:Pkinase_Tyr 242 500 8e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082836
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169940
Meta Mutation Damage Score 0.2286 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.6%
Validation Efficiency 99% (87/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine protein kinase that is activated by autophosphorylation after binding to dsRNA. The activated form of the encoded protein can phosphorylate translation initiation factor EIF2S1, which in turn inhibits protein synthesis. This protein is also activated by manganese ions and heparin. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display altered susceptibility to viral infection. [provided by MGI curators]
Allele List at MGI

 All alleles(7) : Targeted, knock-out(2) Gene trapped(5)
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012P17Rik C A 1: 158,968,912 noncoding transcript Het
9530053A07Rik T C 7: 28,155,594 S1882P probably benign Het
Adam17 G A 12: 21,349,875 R177C probably damaging Het
Ak7 G A 12: 105,745,332 probably null Het
Akap9 T C 5: 3,961,967 V890A probably damaging Het
Alg6 A G 4: 99,738,132 N59S probably damaging Het
Alkbh5 G T 11: 60,538,549 A43S probably benign Het
Anxa2 C A 9: 69,483,817 D162E probably damaging Het
Arap1 A G 7: 101,401,518 H1136R probably benign Het
Arhgap18 A G 10: 26,854,904 R121G probably benign Het
Arhgef4 A T 1: 34,723,810 T716S unknown Het
Atg2a T C 19: 6,250,269 probably null Het
Ccdc27 T C 4: 154,033,313 I480V probably null Het
Cdipt T C 7: 126,976,933 V20A possibly damaging Het
Cgrrf1 C T 14: 46,830,445 probably benign Het
Chd7 G A 4: 8,855,226 V2152I probably benign Het
Chd8 T A 14: 52,215,241 S1274C probably damaging Het
Chuk A T 19: 44,107,343 M17K possibly damaging Het
Col14a1 C T 15: 55,446,181 probably benign Het
Col20a1 G A 2: 181,013,163 probably null Het
Cped1 A G 6: 22,143,964 I570V probably benign Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Ddx27 A C 2: 167,033,771 Q674P probably damaging Het
Dennd6a T A 14: 26,612,003 F131L probably damaging Het
Dhx38 G A 8: 109,556,869 probably benign Het
Dido1 G T 2: 180,659,585 N2175K unknown Het
Dmxl1 T A 18: 49,889,558 Y1654* probably null Het
Dock7 T A 4: 98,959,101 H1658L probably damaging Het
Dync2h1 T A 9: 7,122,772 E2061D probably damaging Het
Dync2h1 T C 9: 7,162,925 I555V probably benign Het
Fabp12 T A 3: 10,250,149 D46V probably benign Het
Fech C T 18: 64,478,727 E79K probably damaging Het
Flnc A T 6: 29,444,363 I693F probably damaging Het
Foxp2 G A 6: 15,324,644 C97Y possibly damaging Het
Grin2b A G 6: 135,733,896 M884T probably benign Het
Gtf2ird1 T C 5: 134,417,093 D28G probably damaging Het
Gtf3c4 C A 2: 28,833,894 G468W possibly damaging Het
Ift172 A T 5: 31,267,241 L201* probably null Het
Il1rl2 C A 1: 40,365,214 S498R probably damaging Het
Ildr1 C T 16: 36,725,541 R489W probably damaging Het
Itga10 G A 3: 96,652,490 G487D probably damaging Het
Klk8 A G 7: 43,799,216 N128D probably benign Het
Lgr6 G A 1: 135,075,275 T79M probably damaging Het
Med6 T C 12: 81,573,877 T232A probably benign Het
Mgat4e A G 1: 134,541,322 L328P probably damaging Het
Mttp A G 3: 138,118,402 Y138H probably damaging Het
Ngef T C 1: 87,545,968 R31G probably benign Het
Nipsnap2 C A 5: 129,753,223 probably null Het
Nlgn2 G T 11: 69,828,441 N194K probably damaging Het
Olfr1026 A G 2: 85,923,743 I158M probably benign Het
Olfr1245 A T 2: 89,574,961 M255K possibly damaging Het
Olfr1450 G A 19: 12,954,332 V248I possibly damaging Het
Olfr357 G A 2: 36,997,652 V281M possibly damaging Het
Olfr894 A G 9: 38,219,432 Y203C possibly damaging Het
Pcca T A 14: 122,813,222 M101K possibly damaging Het
Plekha6 A G 1: 133,284,970 T671A possibly damaging Het
Prex2 G A 1: 11,162,312 V868M probably damaging Het
Prkcq G A 2: 11,279,521 V501I probably benign Het
Prom1 T A 5: 44,011,253 probably benign Het
Ptprd A G 4: 76,133,161 V41A probably damaging Het
Rab39 C T 9: 53,686,398 G189E possibly damaging Het
Ret T C 6: 118,180,382 K236E possibly damaging Het
Rfx6 G A 10: 51,720,057 probably null Het
Rnf213 A G 11: 119,461,918 T3916A probably damaging Het
Rpn1 A G 6: 88,095,683 N336S probably damaging Het
Sag G A 1: 87,805,315 A2T probably damaging Het
Sco2 T C 15: 89,371,860 Y197C probably damaging Het
Sec23b T C 2: 144,566,944 I183T possibly damaging Het
Sec24b C T 3: 129,987,728 V1166M probably damaging Het
Slc27a5 A T 7: 12,993,412 F361Y probably damaging Het
Spaca9 A G 2: 28,696,001 L17P probably damaging Het
Sqor T C 2: 122,804,107 probably null Het
Stx18 A G 5: 38,135,244 H230R probably damaging Het
Tas2r130 A T 6: 131,630,769 I21N probably damaging Het
Tcaf3 A G 6: 42,593,724 S365P possibly damaging Het
Tinagl1 G A 4: 130,166,972 H351Y probably damaging Het
Tmc2 T C 2: 130,232,385 Y333H probably damaging Het
Trp53bp2 A T 1: 182,442,819 T395S probably damaging Het
Tsc22d1 T C 14: 76,418,333 S751P probably damaging Het
Ttc30a1 A G 2: 75,980,935 V268A probably benign Het
Ttn A G 2: 76,827,024 probably benign Het
Ugdh T C 5: 65,416,925 Y425C probably damaging Het
Vmn1r115 G A 7: 20,844,169 L273F probably null Het
Vmn2r109 A T 17: 20,541,186 C636* probably null Het
Vmn2r59 A C 7: 42,043,779 Y466D probably damaging Het
Zic5 C T 14: 122,464,830 G163D unknown Het
Other mutations in Eif2ak2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Eif2ak2 APN 17 78869483 missense probably benign 0.00
IGL01017:Eif2ak2 APN 17 78863858 missense probably damaging 1.00
IGL01068:Eif2ak2 APN 17 78865371 missense probably damaging 1.00
3-1:Eif2ak2 UTSW 17 78869498 missense probably benign 0.00
R0038:Eif2ak2 UTSW 17 78863955 missense probably benign
R0801:Eif2ak2 UTSW 17 78866349 nonsense probably null
R1702:Eif2ak2 UTSW 17 78856634 missense probably damaging 1.00
R2159:Eif2ak2 UTSW 17 78874018 missense possibly damaging 0.77
R3405:Eif2ak2 UTSW 17 78858639 splice site probably benign
R3406:Eif2ak2 UTSW 17 78858639 splice site probably benign
R4355:Eif2ak2 UTSW 17 78858534 missense probably benign 0.08
R5135:Eif2ak2 UTSW 17 78866345 missense probably damaging 0.96
R5145:Eif2ak2 UTSW 17 78876204 missense possibly damaging 0.60
R5336:Eif2ak2 UTSW 17 78874043 missense probably benign 0.00
R6195:Eif2ak2 UTSW 17 78871233 nonsense probably null
R6233:Eif2ak2 UTSW 17 78871233 nonsense probably null
R6417:Eif2ak2 UTSW 17 78856619 missense probably damaging 1.00
R6737:Eif2ak2 UTSW 17 78863948 missense probably benign 0.00
R7108:Eif2ak2 UTSW 17 78858536 nonsense probably null
R7238:Eif2ak2 UTSW 17 78866331 missense probably benign 0.01
R7830:Eif2ak2 UTSW 17 78866403 missense probably damaging 1.00
R7843:Eif2ak2 UTSW 17 78868774 missense probably benign 0.24
R7845:Eif2ak2 UTSW 17 78863898 missense probably damaging 1.00
R8003:Eif2ak2 UTSW 17 78876223 missense probably damaging 0.99
R8143:Eif2ak2 UTSW 17 78858532 missense probably benign 0.09
R9658:Eif2ak2 UTSW 17 78876203 missense probably benign 0.00
R9719:Eif2ak2 UTSW 17 78855354 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ATCGTGACTAACTGCCAATCAC -3'
(R):5'- CAATCGAAGCTCTGGATGCTTG -3'

Sequencing Primer
(F):5'- TCGTGACTAACTGCCAATCACAAATC -3'
(R):5'- CTCTGGATGCTTGGGAAATTATGAC -3'
Posted On 2014-08-25