Incidental Mutation 'R1993:Dchs1'
ID223906
Institutional Source Beutler Lab
Gene Symbol Dchs1
Ensembl Gene ENSMUSG00000036862
Gene Namedachsous cadherin related 1
Synonyms3110041P15Rik, C130033F22Rik
MMRRC Submission 040004-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1993 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location105752990-105787654 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 105762548 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 1454 (S1454T)
Ref Sequence ENSEMBL: ENSMUSP00000077574 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078482]
Predicted Effect probably benign
Transcript: ENSMUST00000078482
AA Change: S1454T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000077574
Gene: ENSMUSG00000036862
AA Change: S1454T

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
CA 58 135 5.2e-11 SMART
CA 159 247 6.1e-17 SMART
CA 271 354 2.6e-30 SMART
CA 382 464 7.8e-26 SMART
CA 489 570 1.2e-34 SMART
CA 594 677 1.9e-27 SMART
CA 701 782 5.3e-11 SMART
CA 806 886 1e-12 SMART
CA 910 990 3.3e-14 SMART
CA 1016 1097 3.6e-18 SMART
CA 1121 1203 3.1e-34 SMART
CA 1233 1307 8.8e-16 SMART
low complexity region 1323 1335 N/A INTRINSIC
CA 1344 1427 9.9e-9 SMART
CA 1451 1537 1.5e-23 SMART
CA 1560 1640 7.2e-32 SMART
CA 1664 1742 1.8e-31 SMART
CA 1765 1846 7.8e-30 SMART
CA 1870 1951 3.7e-26 SMART
low complexity region 1957 1965 N/A INTRINSIC
CA 1979 2059 1.1e-6 SMART
CA 2083 2162 2.7e-18 SMART
CA 2186 2268 2.2e-26 SMART
CA 2291 2367 1e-18 SMART
CA 2391 2473 1.8e-23 SMART
CA 2497 2593 3.5e-21 SMART
CA 2617 2697 1.2e-25 SMART
CA 2721 2804 1.9e-18 SMART
CA 2828 2919 3e-3 SMART
transmembrane domain 2932 2954 N/A INTRINSIC
low complexity region 3001 3017 N/A INTRINSIC
low complexity region 3046 3055 N/A INTRINSIC
low complexity region 3088 3097 N/A INTRINSIC
low complexity region 3185 3196 N/A INTRINSIC
low complexity region 3237 3259 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131504
Predicted Effect probably benign
Transcript: ENSMUST00000140959
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154659
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily whose members encode calcium-dependent cell-cell adhesion molecules. The encoded protein has a signal peptide, 27 cadherin repeat domains and a unique cytoplasmic region. This particular cadherin family member is expressed in fibroblasts but not in melanocytes or keratinocytes. The cell-cell adhesion of fibroblasts is thought to be necessary for wound healing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality, growth retardation, small lungs, abnormal cochlea morphology, abnormal kidney morphology, cardiovascular abnormalities and skeletal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T G 5: 8,821,322 I292S possibly damaging Het
Abcc4 T C 14: 118,526,282 N1047S probably benign Het
Abcc8 G T 7: 46,117,423 probably null Het
Akap9 T A 5: 4,038,520 probably null Het
Alox5 T A 6: 116,415,463 I366F probably damaging Het
Amn A G 12: 111,276,092 N447S probably damaging Het
Ankrd22 A T 19: 34,165,774 M1K probably null Het
Asic1 G T 15: 99,671,884 G29C probably damaging Het
Atxn7l1 A G 12: 33,345,977 N235S probably benign Het
AY358078 T A 14: 51,826,062 D388E probably damaging Het
Bod1l A G 5: 41,817,336 S2212P probably damaging Het
Cacna1e T A 1: 154,477,817 Q423L probably damaging Het
Calu T C 6: 29,366,975 I62T possibly damaging Het
Cars2 A G 8: 11,514,515 V75A probably benign Het
Catsperb T A 12: 101,602,767 N899K possibly damaging Het
Ccdc50 T A 16: 27,409,339 C86* probably null Het
Cdh5 G T 8: 104,137,815 L469F probably damaging Het
Clrn3 A T 7: 135,514,119 D167E probably benign Het
Csmd1 A T 8: 16,346,684 C411S probably damaging Het
Ddx20 G A 3: 105,679,344 Q562* probably null Het
Dgkg T G 16: 22,600,594 Y52S probably damaging Het
Dhx58 T C 11: 100,703,490 probably null Het
Dpp6 A T 5: 27,399,006 I145L probably benign Het
Efna2 A T 10: 80,186,877 Y85F possibly damaging Het
Eif3a C T 19: 60,781,516 V127I probably benign Het
Exph5 A T 9: 53,373,635 H672L possibly damaging Het
Fam131b T C 6: 42,320,884 T112A possibly damaging Het
Fam71e2 A T 7: 4,758,018 V565E probably damaging Het
Fcgr1 A T 3: 96,285,868 V271E probably damaging Het
Fgfr4 A G 13: 55,165,902 D508G probably damaging Het
Fndc3b A G 3: 27,419,400 M1172T probably benign Het
Fryl G T 5: 73,108,493 T495K probably damaging Het
Gm5134 A T 10: 75,966,393 I93F probably damaging Het
Gpbar1 G A 1: 74,279,444 G282D possibly damaging Het
Gria2 G A 3: 80,802,357 L10F probably benign Het
Grm7 T C 6: 111,207,808 Y367H probably benign Het
Hils1 T A 11: 94,968,032 V51E probably damaging Het
Hivep1 G A 13: 42,157,493 A1070T probably benign Het
Il33 A G 19: 29,956,904 D155G possibly damaging Het
Kdm6b T C 11: 69,406,303 S408G probably null Het
Kntc1 G A 5: 123,759,099 probably null Het
Kntc1 A G 5: 123,810,811 probably null Het
Ltbp2 T G 12: 84,808,446 probably null Het
Mapk8ip3 G T 17: 24,914,588 L83I probably damaging Het
Meltf C A 16: 31,892,622 Y554* probably null Het
Mov10 A C 3: 104,799,419 F725C probably damaging Het
Ms4a6d A C 19: 11,590,159 L18R probably damaging Het
Naip2 T C 13: 100,162,007 N507S probably benign Het
Nodal A G 10: 61,418,334 Q12R probably benign Het
Npy6r T C 18: 44,276,508 L332P probably damaging Het
Nrxn3 A G 12: 89,260,411 K272R possibly damaging Het
Obox2 G T 7: 15,397,249 K93N probably benign Het
Olfr1136 C T 2: 87,693,433 V150M probably benign Het
Olfr1408 C T 1: 173,130,851 R122H possibly damaging Het
Olfr1466 A G 19: 13,341,814 T19A possibly damaging Het
Olfr575 G T 7: 102,954,746 P285Q probably damaging Het
Pcdh12 T A 18: 38,282,143 D643V possibly damaging Het
Pcsk2 A G 2: 143,687,619 D112G probably benign Het
Pms1 A G 1: 53,195,015 S781P probably benign Het
Prtg A G 9: 72,844,896 D188G probably benign Het
Psg21 A T 7: 18,654,770 N132K probably benign Het
Psip1 A G 4: 83,482,532 V25A probably damaging Het
Psmd13 T A 7: 140,898,194 I319N probably damaging Het
Ptges2 A G 2: 32,400,092 T173A probably benign Het
Ptprm G A 17: 66,747,160 R975W probably damaging Het
Rdh1 A G 10: 127,765,345 D254G probably benign Het
Rnf138 T G 18: 21,024,483 N212K probably damaging Het
Serpine2 A G 1: 79,821,442 S32P probably damaging Het
Serpini1 G T 3: 75,614,664 W154L probably damaging Het
Sf3a1 C A 11: 4,179,177 Q713K possibly damaging Het
Sgo2b A T 8: 63,926,833 H988Q probably benign Het
Sin3a T C 9: 57,101,199 F468L probably damaging Het
Slamf6 A T 1: 171,934,209 I66F possibly damaging Het
Slc22a28 A T 19: 8,117,124 C178S possibly damaging Het
Slc35a1 A C 4: 34,675,181 V119G probably damaging Het
Slc39a12 A T 2: 14,434,219 H428L probably damaging Het
Speer2 A G 16: 69,858,077 S167P probably benign Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Spsb2 T C 6: 124,809,366 probably null Het
Stam2 A T 2: 52,703,156 Y341* probably null Het
Sv2b G A 7: 75,206,341 A67V probably benign Het
Svep1 A G 4: 58,064,170 probably null Het
Syt15 A T 14: 34,223,012 Q172L probably benign Het
T G A 17: 8,441,802 S415N probably benign Het
Tep1 A G 14: 50,824,184 F2625S possibly damaging Het
Tex14 T C 11: 87,536,755 V11A possibly damaging Het
Tiam2 A T 17: 3,415,126 R377* probably null Het
Tirap A G 9: 35,191,016 probably null Het
Tm4sf20 T C 1: 82,760,217 T118A probably benign Het
Trank1 A T 9: 111,378,832 Q1715L probably benign Het
Trpm2 C T 10: 77,947,989 V217M probably damaging Het
Ubap1l G A 9: 65,371,796 E126K possibly damaging Het
Urgcp G T 11: 5,716,526 P604Q probably damaging Het
Vmn1r63 A G 7: 5,803,255 V126A probably benign Het
Vmn2r90 T C 17: 17,713,263 C362R probably damaging Het
Vmn2r96 A G 17: 18,583,876 I271V probably damaging Het
Vps13a A T 19: 16,722,458 I740K probably benign Het
Vps13c A G 9: 67,975,856 T3562A probably damaging Het
Wdr91 T A 6: 34,892,362 H409L probably damaging Het
Wnt7a T A 6: 91,365,956 T315S possibly damaging Het
Zfp616 A G 11: 74,084,969 H688R probably benign Het
Zfp763 A T 17: 33,018,439 H577Q probably damaging Het
Zfp808 G A 13: 62,172,907 S650N probably benign Het
Zfp977 A T 7: 42,579,985 M372K probably benign Het
Other mutations in Dchs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Dchs1 APN 7 105758743 missense probably damaging 1.00
IGL00422:Dchs1 APN 7 105758029 missense possibly damaging 0.88
IGL00427:Dchs1 APN 7 105758424 missense probably damaging 0.98
IGL00469:Dchs1 APN 7 105755261 missense probably damaging 1.00
IGL00470:Dchs1 APN 7 105758207 missense probably damaging 1.00
IGL00534:Dchs1 APN 7 105757943 missense probably benign
IGL01292:Dchs1 APN 7 105760891 missense probably damaging 0.98
IGL01380:Dchs1 APN 7 105762211 missense probably damaging 1.00
IGL01396:Dchs1 APN 7 105772283 missense probably damaging 1.00
IGL01448:Dchs1 APN 7 105771927 missense probably damaging 0.98
IGL01759:Dchs1 APN 7 105755302 missense probably benign 0.00
IGL01829:Dchs1 APN 7 105755397 missense probably damaging 0.99
IGL01946:Dchs1 APN 7 105759105 missense probably damaging 1.00
IGL01955:Dchs1 APN 7 105757591 missense probably benign 0.00
IGL02012:Dchs1 APN 7 105764297 missense probably damaging 0.98
IGL02222:Dchs1 APN 7 105764887 missense probably damaging 1.00
IGL02261:Dchs1 APN 7 105772569 missense probably damaging 1.00
IGL02365:Dchs1 APN 7 105755188 missense probably benign 0.22
IGL02430:Dchs1 APN 7 105771971 missense probably benign 0.34
IGL02500:Dchs1 APN 7 105755806 missense probably benign
IGL02741:Dchs1 APN 7 105757323 missense probably damaging 1.00
IGL02890:Dchs1 APN 7 105756491 missense probably damaging 1.00
IGL03213:Dchs1 APN 7 105755072 missense probably damaging 1.00
P0026:Dchs1 UTSW 7 105758405 missense probably damaging 0.99
PIT4377001:Dchs1 UTSW 7 105757588 missense probably damaging 1.00
PIT4791001:Dchs1 UTSW 7 105758971 missense probably damaging 1.00
R0013:Dchs1 UTSW 7 105755836 missense possibly damaging 0.90
R0090:Dchs1 UTSW 7 105755932 missense probably benign 0.18
R0091:Dchs1 UTSW 7 105766094 splice site probably benign
R0193:Dchs1 UTSW 7 105764983 missense probably benign 0.40
R0395:Dchs1 UTSW 7 105758538 missense probably damaging 1.00
R0448:Dchs1 UTSW 7 105765927 missense probably benign 0.00
R0480:Dchs1 UTSW 7 105771489 missense probably benign 0.14
R0485:Dchs1 UTSW 7 105772727 missense probably benign 0.00
R0566:Dchs1 UTSW 7 105759195 missense probably benign 0.00
R0571:Dchs1 UTSW 7 105771996 missense probably damaging 1.00
R0573:Dchs1 UTSW 7 105758778 missense probably damaging 0.98
R0577:Dchs1 UTSW 7 105764255 missense possibly damaging 0.78
R0622:Dchs1 UTSW 7 105763449 missense probably damaging 1.00
R0654:Dchs1 UTSW 7 105772349 missense probably damaging 1.00
R0677:Dchs1 UTSW 7 105764984 missense probably damaging 1.00
R1171:Dchs1 UTSW 7 105757714 missense probably benign
R1241:Dchs1 UTSW 7 105758178 missense probably damaging 1.00
R1389:Dchs1 UTSW 7 105755571 missense probably benign 0.40
R1427:Dchs1 UTSW 7 105766191 missense probably benign 0.06
R1458:Dchs1 UTSW 7 105755244 missense probably damaging 1.00
R1513:Dchs1 UTSW 7 105772071 nonsense probably null
R1524:Dchs1 UTSW 7 105764525 missense probably damaging 1.00
R1525:Dchs1 UTSW 7 105758931 missense probably damaging 1.00
R1534:Dchs1 UTSW 7 105772040 missense probably damaging 0.98
R1567:Dchs1 UTSW 7 105771861 missense probably benign 0.01
R1577:Dchs1 UTSW 7 105765955 missense probably damaging 1.00
R1603:Dchs1 UTSW 7 105762770 missense probably benign 0.24
R1676:Dchs1 UTSW 7 105754921 missense probably benign 0.40
R1794:Dchs1 UTSW 7 105771720 missense probably benign 0.02
R1826:Dchs1 UTSW 7 105757627 missense probably damaging 1.00
R1892:Dchs1 UTSW 7 105764156 missense probably benign 0.00
R1924:Dchs1 UTSW 7 105772280 missense possibly damaging 0.81
R1932:Dchs1 UTSW 7 105765902 missense probably damaging 1.00
R1962:Dchs1 UTSW 7 105764201 missense probably damaging 1.00
R1985:Dchs1 UTSW 7 105772398 missense possibly damaging 0.72
R2007:Dchs1 UTSW 7 105755325 missense probably damaging 1.00
R2316:Dchs1 UTSW 7 105764204 missense possibly damaging 0.71
R2351:Dchs1 UTSW 7 105754094 missense probably benign
R2474:Dchs1 UTSW 7 105755074 missense probably benign 0.37
R2474:Dchs1 UTSW 7 105772838 missense probably damaging 1.00
R3429:Dchs1 UTSW 7 105756504 missense possibly damaging 0.85
R3430:Dchs1 UTSW 7 105756504 missense possibly damaging 0.85
R3737:Dchs1 UTSW 7 105762316 missense possibly damaging 0.88
R3767:Dchs1 UTSW 7 105757085 missense possibly damaging 0.67
R3874:Dchs1 UTSW 7 105761635 missense probably damaging 1.00
R3883:Dchs1 UTSW 7 105762563 missense probably damaging 1.00
R4105:Dchs1 UTSW 7 105765140 missense probably damaging 1.00
R4209:Dchs1 UTSW 7 105766190 missense probably damaging 0.99
R4329:Dchs1 UTSW 7 105753759 missense probably damaging 1.00
R4516:Dchs1 UTSW 7 105754852 missense probably damaging 1.00
R4579:Dchs1 UTSW 7 105754765 missense probably damaging 1.00
R4579:Dchs1 UTSW 7 105758973 missense probably benign
R4588:Dchs1 UTSW 7 105756041 missense probably benign
R4613:Dchs1 UTSW 7 105772724 missense probably damaging 1.00
R4632:Dchs1 UTSW 7 105754355 missense probably benign 0.02
R4696:Dchs1 UTSW 7 105764627 missense probably damaging 1.00
R4725:Dchs1 UTSW 7 105755253 missense probably damaging 0.98
R4725:Dchs1 UTSW 7 105765552 missense probably damaging 1.00
R4738:Dchs1 UTSW 7 105758673 missense probably damaging 0.96
R4768:Dchs1 UTSW 7 105771620 missense possibly damaging 0.96
R4784:Dchs1 UTSW 7 105765926 missense probably damaging 1.00
R4864:Dchs1 UTSW 7 105755253 missense probably damaging 0.98
R4880:Dchs1 UTSW 7 105755730 missense probably benign 0.00
R4909:Dchs1 UTSW 7 105766255 missense probably damaging 1.00
R5102:Dchs1 UTSW 7 105772177 missense probably benign 0.09
R5109:Dchs1 UTSW 7 105765014 missense probably benign
R5126:Dchs1 UTSW 7 105753517 missense probably damaging 1.00
R5149:Dchs1 UTSW 7 105755658 missense probably damaging 0.98
R5330:Dchs1 UTSW 7 105754602 missense probably damaging 1.00
R5384:Dchs1 UTSW 7 105758029 missense probably damaging 1.00
R5384:Dchs1 UTSW 7 105772055 missense probably damaging 1.00
R5386:Dchs1 UTSW 7 105758029 missense probably damaging 1.00
R5622:Dchs1 UTSW 7 105755293 missense probably benign 0.11
R5623:Dchs1 UTSW 7 105772769 missense probably damaging 1.00
R5708:Dchs1 UTSW 7 105772809 missense probably damaging 1.00
R5718:Dchs1 UTSW 7 105755748 missense probably benign 0.01
R5743:Dchs1 UTSW 7 105771596 missense probably benign
R5759:Dchs1 UTSW 7 105764176 missense probably damaging 0.99
R5772:Dchs1 UTSW 7 105773040 missense probably damaging 1.00
R5860:Dchs1 UTSW 7 105772035 missense probably damaging 1.00
R5916:Dchs1 UTSW 7 105759166 missense probably damaging 1.00
R5965:Dchs1 UTSW 7 105755925 missense probably damaging 1.00
R5997:Dchs1 UTSW 7 105754095 missense probably benign 0.08
R6065:Dchs1 UTSW 7 105755421 missense probably damaging 1.00
R6136:Dchs1 UTSW 7 105760925 missense probably benign
R6137:Dchs1 UTSW 7 105765106 missense probably damaging 0.99
R6324:Dchs1 UTSW 7 105764938 missense probably benign 0.05
R6363:Dchs1 UTSW 7 105758472 missense probably benign 0.12
R6466:Dchs1 UTSW 7 105764541 missense probably benign 0.09
R6544:Dchs1 UTSW 7 105758178 missense probably damaging 1.00
R6572:Dchs1 UTSW 7 105758806 missense possibly damaging 0.94
R6579:Dchs1 UTSW 7 105762913 missense probably benign 0.17
R6632:Dchs1 UTSW 7 105761878 missense probably damaging 1.00
R6725:Dchs1 UTSW 7 105758793 missense probably damaging 0.99
R6789:Dchs1 UTSW 7 105757003 missense possibly damaging 0.61
R6868:Dchs1 UTSW 7 105763503 missense possibly damaging 0.91
R7058:Dchs1 UTSW 7 105757021 missense probably benign
R7064:Dchs1 UTSW 7 105763185 missense probably damaging 0.99
R7076:Dchs1 UTSW 7 105761871 missense probably benign 0.04
R7191:Dchs1 UTSW 7 105765439 missense possibly damaging 0.89
R7298:Dchs1 UTSW 7 105755131 nonsense probably null
R7380:Dchs1 UTSW 7 105758628 missense probably benign 0.35
R7438:Dchs1 UTSW 7 105754948 missense probably benign 0.30
R7496:Dchs1 UTSW 7 105761859 missense probably damaging 1.00
R7534:Dchs1 UTSW 7 105772373 missense probably benign 0.00
R7604:Dchs1 UTSW 7 105765982 missense probably damaging 1.00
R7631:Dchs1 UTSW 7 105759238 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCATCTGTGACAAAGACGCG -3'
(R):5'- CCTATACTCTGGTTGGTGGC -3'

Sequencing Primer
(F):5'- TGACAAAGACGCGCGCTG -3'
(R):5'- TCCCTTGGACTTCGAGGCTG -3'
Posted On2014-08-25