Incidental Mutation 'R0142:Crybg1'
ID 22391
Institutional Source Beutler Lab
Gene Symbol Crybg1
Ensembl Gene ENSMUSG00000019866
Gene Name crystallin beta-gamma domain containing 1
Synonyms Aim1
MMRRC Submission 038427-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0142 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 10
Chromosomal Location 43826632-44024849 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 43875059 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 683 (T683I)
Ref Sequence ENSEMBL: ENSMUSP00000143429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020017] [ENSMUST00000200401]
AlphaFold A0A0G2JG52
Predicted Effect possibly damaging
Transcript: ENSMUST00000020017
AA Change: T309I

PolyPhen 2 Score 0.784 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000020017
Gene: ENSMUSG00000019866
AA Change: T309I

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
low complexity region 114 121 N/A INTRINSIC
low complexity region 176 192 N/A INTRINSIC
low complexity region 436 453 N/A INTRINSIC
low complexity region 507 518 N/A INTRINSIC
low complexity region 544 557 N/A INTRINSIC
low complexity region 837 857 N/A INTRINSIC
XTALbg 995 1078 8.57e-9 SMART
XTALbg 1094 1175 4.73e-20 SMART
XTALbg 1189 1282 1.23e-32 SMART
XTALbg 1290 1373 9.3e-28 SMART
XTALbg 1386 1465 1.66e-24 SMART
XTALbg 1473 1553 5.29e-32 SMART
RICIN 1556 1689 5.86e-15 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000200401
AA Change: T683I

PolyPhen 2 Score 0.826 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000143429
Gene: ENSMUSG00000019866
AA Change: T683I

DomainStartEndE-ValueType
low complexity region 377 390 N/A INTRINSIC
low complexity region 488 495 N/A INTRINSIC
low complexity region 550 566 N/A INTRINSIC
low complexity region 810 827 N/A INTRINSIC
low complexity region 881 892 N/A INTRINSIC
low complexity region 918 931 N/A INTRINSIC
low complexity region 1211 1231 N/A INTRINSIC
XTALbg 1369 1452 5.4e-11 SMART
XTALbg 1468 1549 2.9e-22 SMART
XTALbg 1563 1656 7.9e-35 SMART
XTALbg 1664 1747 6e-30 SMART
XTALbg 1760 1839 1.1e-26 SMART
XTALbg 1847 1927 3.3e-34 SMART
RICIN 1930 2063 3.3e-17 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 87.6%
Validation Efficiency 92% (61/66)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T G 11: 110,079,467 (GRCm39) D1229A probably damaging Het
Abhd8 A C 8: 71,914,506 (GRCm39) F41V probably damaging Het
Ago4 T G 4: 126,410,725 (GRCm39) E222A probably benign Het
Ap3b2 T C 7: 81,122,828 (GRCm39) I470V probably damaging Het
Bcl9l C T 9: 44,418,409 (GRCm39) T749M probably benign Het
Bicc1 T C 10: 70,761,200 (GRCm39) K937E probably damaging Het
Bmi1 G A 2: 18,688,095 (GRCm39) probably null Het
Boc A C 16: 44,310,604 (GRCm39) I772S probably damaging Het
Brd10 A G 19: 29,695,654 (GRCm39) S1347P possibly damaging Het
C2 T A 17: 35,092,504 (GRCm39) I178F possibly damaging Het
Cacna1c G T 6: 118,580,843 (GRCm39) A1416E probably damaging Het
Chst10 A G 1: 38,910,810 (GRCm39) L118P probably damaging Het
Cul5 C T 9: 53,546,350 (GRCm39) V314I probably damaging Het
Dnajc17 C A 2: 119,010,415 (GRCm39) R211I probably benign Het
Emilin1 A G 5: 31,071,264 (GRCm39) T16A probably benign Het
Ercc6l2 A C 13: 64,020,320 (GRCm39) probably benign Het
Fsd2 T A 7: 81,209,683 (GRCm39) D53V probably damaging Het
Galnt13 A G 2: 54,988,615 (GRCm39) D479G probably damaging Het
Grk3 A T 5: 113,062,919 (GRCm39) W643R probably damaging Het
Hdgf G A 3: 87,820,416 (GRCm39) A4T possibly damaging Het
Hnrnpr T A 4: 136,054,593 (GRCm39) V182E probably damaging Het
Ipo13 A C 4: 117,762,766 (GRCm39) L279R probably damaging Het
Itga9 C A 9: 118,465,654 (GRCm39) N169K probably damaging Het
Jph3 A G 8: 122,480,110 (GRCm39) T263A possibly damaging Het
Jph4 G T 14: 55,345,783 (GRCm39) Q625K probably benign Het
Kctd3 A C 1: 188,728,595 (GRCm39) probably null Het
Kif26b A T 1: 178,742,954 (GRCm39) S570C probably damaging Het
Klhl5 G A 5: 65,300,693 (GRCm39) W164* probably null Het
Lacc1 A T 14: 77,268,239 (GRCm39) H357Q probably benign Het
Lama2 A G 10: 27,063,841 (GRCm39) I1316T probably benign Het
Lcp2 C T 11: 34,032,418 (GRCm39) P332L probably damaging Het
Map3k6 A T 4: 132,978,257 (GRCm39) H1033L probably benign Het
Mfsd2b A G 12: 4,916,234 (GRCm39) V252A probably benign Het
Myo16 T A 8: 10,619,790 (GRCm39) I1447N probably benign Het
Myo19 G A 11: 84,785,429 (GRCm39) R224H probably damaging Het
Myo5a C T 9: 75,067,856 (GRCm39) H637Y probably benign Het
Nek10 C T 14: 14,861,560 (GRCm38) R539C possibly damaging Het
Nfix A T 8: 85,448,315 (GRCm39) V404E probably damaging Het
Nr1i2 T C 16: 38,073,368 (GRCm39) R203G probably benign Het
Nup210l G A 3: 90,079,420 (GRCm39) G968D probably damaging Het
Or10q1 A T 19: 13,726,619 (GRCm39) I50F probably benign Het
Or2ag15 G T 7: 106,340,972 (GRCm39) H56Q probably benign Het
Or8b37 A T 9: 37,959,406 (GRCm39) H296L probably benign Het
Phlpp2 C T 8: 110,634,145 (GRCm39) R242W probably damaging Het
Plcz1 A G 6: 139,953,423 (GRCm39) F398S probably damaging Het
Ppfibp2 C A 7: 107,343,384 (GRCm39) P808T probably damaging Het
Srpk2 T C 5: 23,732,928 (GRCm39) K239E probably damaging Het
Svep1 A G 4: 58,118,232 (GRCm39) V830A probably benign Het
Tesc A T 5: 118,194,635 (GRCm39) I149F possibly damaging Het
Thsd7a A G 6: 12,418,334 (GRCm39) W632R probably damaging Het
Tmprss9 A G 10: 80,730,212 (GRCm39) D704G possibly damaging Het
Tob1 T C 11: 94,105,423 (GRCm39) Y320H probably damaging Het
Trpm3 G T 19: 22,965,280 (GRCm39) D1582Y probably damaging Het
Ttc28 A G 5: 111,425,323 (GRCm39) K1716R probably benign Het
Uqcrfs1 A G 13: 30,724,925 (GRCm39) V205A probably benign Het
Usp29 G A 7: 6,965,334 (GRCm39) M392I probably benign Het
Uspl1 A T 5: 149,125,159 (GRCm39) Y22F possibly damaging Het
Virma C A 4: 11,548,783 (GRCm39) N1780K probably benign Het
Vmn1r56 C T 7: 5,199,372 (GRCm39) A82T probably benign Het
Vmn2r5 A T 3: 64,400,009 (GRCm39) C553S probably damaging Het
Vwce A T 19: 10,641,976 (GRCm39) R901W probably damaging Het
Wdpcp C A 11: 21,807,444 (GRCm39) probably null Het
Zfp423 A T 8: 88,506,968 (GRCm39) C1000* probably null Het
Zscan20 A G 4: 128,479,630 (GRCm39) F954L probably benign Het
Other mutations in Crybg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Crybg1 APN 10 43,868,505 (GRCm39) missense probably damaging 1.00
IGL00502:Crybg1 APN 10 43,834,309 (GRCm39) missense probably damaging 1.00
IGL00848:Crybg1 APN 10 43,843,814 (GRCm39) splice site probably null
IGL01287:Crybg1 APN 10 43,868,490 (GRCm39) missense possibly damaging 0.53
IGL01310:Crybg1 APN 10 43,879,596 (GRCm39) missense probably damaging 0.99
IGL01310:Crybg1 APN 10 43,851,054 (GRCm39) missense possibly damaging 0.95
IGL02683:Crybg1 APN 10 43,865,212 (GRCm39) missense possibly damaging 0.64
IGL03095:Crybg1 APN 10 43,865,245 (GRCm39) missense probably damaging 1.00
R0062:Crybg1 UTSW 10 43,873,902 (GRCm39) missense probably damaging 0.98
R0294:Crybg1 UTSW 10 43,862,372 (GRCm39) missense probably damaging 1.00
R0539:Crybg1 UTSW 10 43,874,894 (GRCm39) missense probably benign 0.03
R0781:Crybg1 UTSW 10 43,875,089 (GRCm39) missense possibly damaging 0.95
R1110:Crybg1 UTSW 10 43,875,089 (GRCm39) missense possibly damaging 0.95
R1189:Crybg1 UTSW 10 43,874,790 (GRCm39) missense probably damaging 1.00
R1428:Crybg1 UTSW 10 43,851,074 (GRCm39) missense probably benign 0.33
R1521:Crybg1 UTSW 10 43,874,412 (GRCm39) missense probably damaging 1.00
R1688:Crybg1 UTSW 10 43,849,794 (GRCm39) missense probably damaging 1.00
R1728:Crybg1 UTSW 10 43,880,015 (GRCm39) missense probably damaging 0.97
R1756:Crybg1 UTSW 10 43,862,275 (GRCm39) missense probably damaging 1.00
R1773:Crybg1 UTSW 10 43,868,544 (GRCm39) missense possibly damaging 0.91
R1784:Crybg1 UTSW 10 43,880,015 (GRCm39) missense probably damaging 0.97
R1850:Crybg1 UTSW 10 43,873,670 (GRCm39) missense probably damaging 1.00
R1911:Crybg1 UTSW 10 43,873,673 (GRCm39) missense possibly damaging 0.47
R1920:Crybg1 UTSW 10 43,873,544 (GRCm39) missense probably damaging 1.00
R1964:Crybg1 UTSW 10 43,834,326 (GRCm39) missense probably damaging 1.00
R2298:Crybg1 UTSW 10 43,875,218 (GRCm39) missense probably damaging 1.00
R3617:Crybg1 UTSW 10 43,832,782 (GRCm39) missense possibly damaging 0.82
R3913:Crybg1 UTSW 10 43,874,759 (GRCm39) missense possibly damaging 0.95
R4081:Crybg1 UTSW 10 43,851,035 (GRCm39) missense probably damaging 1.00
R4116:Crybg1 UTSW 10 43,875,158 (GRCm39) missense possibly damaging 0.91
R4409:Crybg1 UTSW 10 43,874,754 (GRCm39) missense possibly damaging 0.94
R4583:Crybg1 UTSW 10 43,873,616 (GRCm39) missense probably damaging 1.00
R4721:Crybg1 UTSW 10 43,873,883 (GRCm39) missense probably damaging 1.00
R4818:Crybg1 UTSW 10 43,874,583 (GRCm39) missense probably benign 0.00
R4859:Crybg1 UTSW 10 43,868,565 (GRCm39) missense probably damaging 1.00
R4933:Crybg1 UTSW 10 43,875,209 (GRCm39) missense probably damaging 1.00
R5028:Crybg1 UTSW 10 43,874,208 (GRCm39) missense possibly damaging 0.74
R5057:Crybg1 UTSW 10 43,865,104 (GRCm39) nonsense probably null
R5102:Crybg1 UTSW 10 43,873,832 (GRCm39) missense probably damaging 1.00
R5103:Crybg1 UTSW 10 43,873,944 (GRCm39) missense probably damaging 1.00
R5137:Crybg1 UTSW 10 43,834,332 (GRCm39) missense probably damaging 1.00
R5212:Crybg1 UTSW 10 43,843,739 (GRCm39) missense possibly damaging 0.95
R5307:Crybg1 UTSW 10 43,879,710 (GRCm39) missense probably benign 0.00
R5353:Crybg1 UTSW 10 43,849,661 (GRCm39) missense probably damaging 1.00
R5463:Crybg1 UTSW 10 43,879,689 (GRCm39) nonsense probably null
R5503:Crybg1 UTSW 10 43,874,762 (GRCm39) missense probably benign 0.00
R5583:Crybg1 UTSW 10 43,879,506 (GRCm39) missense probably benign 0.01
R5835:Crybg1 UTSW 10 43,851,129 (GRCm39) missense probably benign 0.28
R6021:Crybg1 UTSW 10 43,873,534 (GRCm39) missense probably damaging 1.00
R6032:Crybg1 UTSW 10 43,832,756 (GRCm39) missense probably damaging 1.00
R6032:Crybg1 UTSW 10 43,832,756 (GRCm39) missense probably damaging 1.00
R6277:Crybg1 UTSW 10 43,873,255 (GRCm39) missense probably benign 0.03
R6338:Crybg1 UTSW 10 43,868,505 (GRCm39) missense probably damaging 1.00
R6348:Crybg1 UTSW 10 43,879,947 (GRCm39) missense probably damaging 1.00
R6514:Crybg1 UTSW 10 43,873,211 (GRCm39) missense probably damaging 1.00
R6785:Crybg1 UTSW 10 43,875,167 (GRCm39) missense probably benign 0.00
R6804:Crybg1 UTSW 10 43,842,337 (GRCm39) missense probably damaging 1.00
R6938:Crybg1 UTSW 10 43,873,379 (GRCm39) missense probably benign 0.01
R6983:Crybg1 UTSW 10 43,875,338 (GRCm39) missense probably damaging 1.00
R7002:Crybg1 UTSW 10 43,874,831 (GRCm39) missense probably damaging 1.00
R7153:Crybg1 UTSW 10 43,840,662 (GRCm39) missense possibly damaging 0.64
R7271:Crybg1 UTSW 10 43,873,619 (GRCm39) nonsense probably null
R7293:Crybg1 UTSW 10 43,879,428 (GRCm39) missense probably damaging 1.00
R7304:Crybg1 UTSW 10 43,873,254 (GRCm39) missense probably benign 0.05
R7313:Crybg1 UTSW 10 43,865,107 (GRCm39) missense probably damaging 0.98
R7373:Crybg1 UTSW 10 43,880,136 (GRCm39) missense probably benign 0.00
R7449:Crybg1 UTSW 10 43,880,515 (GRCm39) missense probably benign
R7530:Crybg1 UTSW 10 43,875,069 (GRCm39) missense possibly damaging 0.62
R7660:Crybg1 UTSW 10 43,874,831 (GRCm39) missense probably damaging 0.97
R7701:Crybg1 UTSW 10 43,865,139 (GRCm39) missense probably benign 0.06
R8181:Crybg1 UTSW 10 43,862,322 (GRCm39) missense probably damaging 0.98
R8237:Crybg1 UTSW 10 43,842,376 (GRCm39) nonsense probably null
R8359:Crybg1 UTSW 10 43,868,538 (GRCm39) missense probably benign 0.03
R8751:Crybg1 UTSW 10 43,880,838 (GRCm39) missense probably benign 0.04
R8809:Crybg1 UTSW 10 43,879,428 (GRCm39) missense probably damaging 1.00
R9017:Crybg1 UTSW 10 43,880,477 (GRCm39) missense probably benign 0.00
R9069:Crybg1 UTSW 10 43,874,103 (GRCm39) missense probably benign 0.30
R9099:Crybg1 UTSW 10 43,874,844 (GRCm39) missense probably benign 0.01
R9118:Crybg1 UTSW 10 43,879,925 (GRCm39) missense possibly damaging 0.56
R9185:Crybg1 UTSW 10 43,880,091 (GRCm39) missense probably benign 0.04
R9486:Crybg1 UTSW 10 43,880,145 (GRCm39) start gained probably benign
R9561:Crybg1 UTSW 10 43,873,428 (GRCm39) missense probably benign 0.00
RF005:Crybg1 UTSW 10 43,880,741 (GRCm39) missense probably benign 0.03
RF024:Crybg1 UTSW 10 43,880,741 (GRCm39) missense probably benign 0.03
X0065:Crybg1 UTSW 10 43,868,522 (GRCm39) synonymous silent
Z1088:Crybg1 UTSW 10 43,873,307 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTCCTTCACAGGAACCAGAGCAG -3'
(R):5'- CAGCCAGTTCATAAGGGGAACACAG -3'

Sequencing Primer
(F):5'- AGTGTCTGTTTGTACATCCAGC -3'
(R):5'- TCATAAGGGGAACACAGCCAAC -3'
Posted On 2013-04-16