Incidental Mutation 'R2021:Spata31e5'
ID 223910
Institutional Source Beutler Lab
Gene Symbol Spata31e5
Ensembl Gene ENSMUSG00000048411
Gene Name spermatogenesis associated 31 subfamily E member 5
Synonyms Gm597, LOC210962
MMRRC Submission 040030-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.059) question?
Stock # R2021 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 28815203-28819333 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 28817234 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 266 (V266D)
Ref Sequence ENSEMBL: ENSMUSP00000058140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059937]
AlphaFold E9Q8J5
Predicted Effect probably damaging
Transcript: ENSMUST00000059937
AA Change: V266D

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000058140
Gene: ENSMUSG00000048411
AA Change: V266D

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 112 129 N/A INTRINSIC
Pfam:FAM75 137 472 8.1e-14 PFAM
low complexity region 664 675 N/A INTRINSIC
internal_repeat_1 718 807 1.4e-5 PROSPERO
internal_repeat_1 807 894 1.4e-5 PROSPERO
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 A T 19: 57,035,450 (GRCm39) S316T probably damaging Het
Alox8 C T 11: 69,077,114 (GRCm39) V460I probably damaging Het
Aoc1l2 T C 6: 48,908,385 (GRCm39) S462P probably damaging Het
Arvcf G A 16: 18,218,482 (GRCm39) A491T probably damaging Het
Asnsd1 A G 1: 53,386,386 (GRCm39) S414P possibly damaging Het
Btbd7 A G 12: 102,756,968 (GRCm39) L706P probably damaging Het
Camk2d T A 3: 126,574,105 (GRCm39) W171R probably damaging Het
Casc3 T A 11: 98,712,332 (GRCm39) S124T probably benign Het
Casp8ap2 T C 4: 32,644,560 (GRCm39) V1211A probably benign Het
Ccdc182 T C 11: 88,184,962 (GRCm39) V14A possibly damaging Het
Ccdc80 A T 16: 44,943,275 (GRCm39) Q795L probably damaging Het
Ccdc88a T G 11: 29,453,480 (GRCm39) S1614R probably damaging Het
Cemip2 G A 19: 21,822,114 (GRCm39) A1170T possibly damaging Het
Clcn6 A G 4: 148,095,109 (GRCm39) probably null Het
Cubn A G 2: 13,313,360 (GRCm39) V3070A probably benign Het
Dst G A 1: 34,205,372 (GRCm39) V1025I possibly damaging Het
Dynlt4 A G 4: 116,985,504 (GRCm39) E109G possibly damaging Het
Elk3 T A 10: 93,101,539 (GRCm39) I71F probably damaging Het
Flt3 A T 5: 147,306,300 (GRCm39) I276N probably damaging Het
Frem1 G T 4: 82,831,795 (GRCm39) T1988K probably benign Het
Golph3l T A 3: 95,524,668 (GRCm39) D306E probably benign Het
Grk2 T A 19: 4,340,698 (GRCm39) I254F probably damaging Het
Hgf C T 5: 16,781,919 (GRCm39) T214I probably benign Het
Hoxc5 C A 15: 102,922,814 (GRCm39) probably null Het
Hsd11b1 T C 1: 192,922,686 (GRCm39) T124A probably benign Het
Ipp A G 4: 116,372,565 (GRCm39) Y198C probably benign Het
Ism1 T A 2: 139,582,047 (GRCm39) probably null Het
Klhl42 A G 6: 146,993,394 (GRCm39) Y122C possibly damaging Het
Klk1b21 A T 7: 43,755,418 (GRCm39) K206* probably null Het
Lcn11 A G 2: 25,668,097 (GRCm39) K85R probably benign Het
Macf1 G T 4: 123,366,523 (GRCm39) A2746E probably damaging Het
Matn4 A G 2: 164,242,573 (GRCm39) V175A probably damaging Het
Myh2 A T 11: 67,082,545 (GRCm39) N1372Y probably damaging Het
Ncl A G 1: 86,284,677 (GRCm39) probably null Het
Nudt2 A G 4: 41,480,255 (GRCm39) D46G probably damaging Het
Obscn C T 11: 58,958,000 (GRCm39) D3567N probably benign Het
Or1j17 G C 2: 36,578,487 (GRCm39) V158L probably benign Het
Or2z9 G T 8: 72,853,930 (GRCm39) V109F possibly damaging Het
Or4a72 A T 2: 89,405,305 (GRCm39) M255K possibly damaging Het
Pamr1 T A 2: 102,464,880 (GRCm39) M343K probably benign Het
Pcdh15 T G 10: 74,467,025 (GRCm39) S1684A possibly damaging Het
Ppm1h T A 10: 122,714,433 (GRCm39) L324* probably null Het
Ppp3r2 T C 4: 49,681,723 (GRCm39) I76V probably benign Het
Prkdc G A 16: 15,494,873 (GRCm39) V748I probably benign Het
Prss47 A G 13: 65,199,591 (GRCm39) V96A probably benign Het
Rsbn1 C T 3: 103,821,789 (GRCm39) T8I probably benign Het
Rsf1 GGCG GGCGACGGCGGCG 7: 97,229,113 (GRCm39) probably benign Het
Serpinb3d A G 1: 107,006,182 (GRCm39) V302A probably benign Het
Sfrp4 A T 13: 19,816,496 (GRCm39) I177F probably benign Het
Sh3bp2 A G 5: 34,701,569 (GRCm39) probably benign Het
Slc7a12 A G 3: 14,562,393 (GRCm39) T257A probably damaging Het
Specc1l T C 10: 75,103,425 (GRCm39) probably null Het
Stard9 A G 2: 120,534,716 (GRCm39) T3658A probably benign Het
Styxl2 A T 1: 165,928,392 (GRCm39) W407R probably benign Het
Tmem30c T C 16: 57,101,725 (GRCm39) T68A probably damaging Het
Tnr A G 1: 159,679,592 (GRCm39) I189V probably benign Het
Trrap A G 5: 144,790,298 (GRCm39) N3586S possibly damaging Het
Usp14 T C 18: 10,024,632 (GRCm39) T22A probably damaging Het
Vmn1r68 A G 7: 10,261,918 (GRCm39) L60P probably damaging Het
Vmn2r108 G A 17: 20,691,252 (GRCm39) H424Y probably benign Het
Wdr81 C A 11: 75,336,788 (GRCm39) E1534* probably null Het
Zc3h13 A G 14: 75,567,635 (GRCm39) E976G probably damaging Het
Zfp128 T C 7: 12,623,956 (GRCm39) L108P possibly damaging Het
Zfp644 T C 5: 106,783,548 (GRCm39) I1000V possibly damaging Het
Other mutations in Spata31e5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00740:Spata31e5 APN 1 28,817,732 (GRCm39) missense possibly damaging 0.94
IGL00885:Spata31e5 APN 1 28,815,926 (GRCm39) missense unknown
IGL01296:Spata31e5 APN 1 28,816,137 (GRCm39) missense probably benign 0.23
IGL01476:Spata31e5 APN 1 28,816,534 (GRCm39) missense probably benign 0.04
IGL02125:Spata31e5 APN 1 28,815,419 (GRCm39) missense possibly damaging 0.91
IGL02410:Spata31e5 APN 1 28,817,712 (GRCm39) missense probably benign 0.25
IGL02982:Spata31e5 APN 1 28,817,135 (GRCm39) missense probably damaging 1.00
IGL03031:Spata31e5 APN 1 28,817,664 (GRCm39) missense probably benign 0.03
IGL03267:Spata31e5 APN 1 28,816,202 (GRCm39) missense probably damaging 1.00
R0294:Spata31e5 UTSW 1 28,817,744 (GRCm39) missense probably benign 0.00
R0433:Spata31e5 UTSW 1 28,816,423 (GRCm39) nonsense probably null
R0485:Spata31e5 UTSW 1 28,817,223 (GRCm39) missense probably damaging 1.00
R0645:Spata31e5 UTSW 1 28,816,011 (GRCm39) missense probably damaging 0.99
R0744:Spata31e5 UTSW 1 28,816,902 (GRCm39) missense possibly damaging 0.46
R0836:Spata31e5 UTSW 1 28,816,902 (GRCm39) missense possibly damaging 0.46
R1036:Spata31e5 UTSW 1 28,816,883 (GRCm39) missense probably benign 0.01
R1302:Spata31e5 UTSW 1 28,815,421 (GRCm39) missense probably benign 0.00
R1394:Spata31e5 UTSW 1 28,815,890 (GRCm39) missense possibly damaging 0.61
R1395:Spata31e5 UTSW 1 28,815,890 (GRCm39) missense possibly damaging 0.61
R1514:Spata31e5 UTSW 1 28,817,829 (GRCm39) missense possibly damaging 0.83
R1535:Spata31e5 UTSW 1 28,816,505 (GRCm39) missense probably damaging 1.00
R2004:Spata31e5 UTSW 1 28,816,260 (GRCm39) missense probably damaging 1.00
R2022:Spata31e5 UTSW 1 28,817,234 (GRCm39) missense probably damaging 0.98
R3115:Spata31e5 UTSW 1 28,815,410 (GRCm39) missense possibly damaging 0.92
R3615:Spata31e5 UTSW 1 28,815,656 (GRCm39) missense probably benign 0.26
R3616:Spata31e5 UTSW 1 28,815,656 (GRCm39) missense probably benign 0.26
R3862:Spata31e5 UTSW 1 28,816,722 (GRCm39) missense probably damaging 0.98
R4067:Spata31e5 UTSW 1 28,816,712 (GRCm39) missense probably damaging 0.98
R4119:Spata31e5 UTSW 1 28,817,054 (GRCm39) missense probably damaging 0.99
R4415:Spata31e5 UTSW 1 28,816,214 (GRCm39) missense probably benign 0.01
R5010:Spata31e5 UTSW 1 28,816,943 (GRCm39) missense possibly damaging 0.52
R5109:Spata31e5 UTSW 1 28,816,636 (GRCm39) missense possibly damaging 0.46
R5122:Spata31e5 UTSW 1 28,819,141 (GRCm39) missense probably benign 0.00
R5533:Spata31e5 UTSW 1 28,817,163 (GRCm39) missense probably damaging 1.00
R6085:Spata31e5 UTSW 1 28,817,308 (GRCm39) missense possibly damaging 0.55
R6116:Spata31e5 UTSW 1 28,817,780 (GRCm39) missense probably benign 0.01
R6750:Spata31e5 UTSW 1 28,816,495 (GRCm39) missense probably damaging 0.98
R6757:Spata31e5 UTSW 1 28,819,191 (GRCm39) missense probably damaging 0.98
R6774:Spata31e5 UTSW 1 28,815,974 (GRCm39) missense probably benign 0.00
R7156:Spata31e5 UTSW 1 28,815,848 (GRCm39) missense possibly damaging 0.53
R7365:Spata31e5 UTSW 1 28,819,233 (GRCm39) missense probably benign 0.04
R7739:Spata31e5 UTSW 1 28,816,689 (GRCm39) missense possibly damaging 0.72
R7996:Spata31e5 UTSW 1 28,817,487 (GRCm39) missense probably damaging 0.98
R8082:Spata31e5 UTSW 1 28,816,579 (GRCm39) missense probably benign 0.08
R8281:Spata31e5 UTSW 1 28,817,225 (GRCm39) missense possibly damaging 0.77
R8514:Spata31e5 UTSW 1 28,817,586 (GRCm39) missense probably damaging 1.00
R8944:Spata31e5 UTSW 1 28,816,155 (GRCm39) missense probably benign 0.00
R9042:Spata31e5 UTSW 1 28,816,037 (GRCm39) missense possibly damaging 0.72
R9101:Spata31e5 UTSW 1 28,815,740 (GRCm39) missense probably benign 0.04
R9106:Spata31e5 UTSW 1 28,815,975 (GRCm39) missense probably benign 0.00
R9173:Spata31e5 UTSW 1 28,816,430 (GRCm39) missense probably benign 0.22
R9596:Spata31e5 UTSW 1 28,815,688 (GRCm39) missense probably benign 0.07
R9632:Spata31e5 UTSW 1 28,817,120 (GRCm39) missense probably benign 0.20
R9656:Spata31e5 UTSW 1 28,816,536 (GRCm39) missense probably benign 0.02
R9659:Spata31e5 UTSW 1 28,816,536 (GRCm39) missense probably benign 0.02
R9661:Spata31e5 UTSW 1 28,816,536 (GRCm39) missense probably benign 0.02
R9663:Spata31e5 UTSW 1 28,816,536 (GRCm39) missense probably benign 0.02
R9710:Spata31e5 UTSW 1 28,817,120 (GRCm39) missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- TGGAAAGCTCCCTGAAGCTG -3'
(R):5'- GGTTCAGGAACAAGAAAACCTC -3'

Sequencing Primer
(F):5'- GCTGTTCCTCAGATGGGAG -3'
(R):5'- GTTCAGGAACAAGAAAACCTCCCAAG -3'
Posted On 2014-08-25