Mutagenetix > Incidental Mutations

Incidental Mutation 'R2021:Dusp27'

223923

Institutional Source

Beutler Lab

Gene Symbol

Dusp27

Ensembl Gene

ENSMUSG00000026564

Gene Name

dual specificity phosphatase 27 (putative)

Synonyms

C130085G02Rik

MMRRC Submission

040030-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2021 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

166098148-166127922 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 166100823 bp

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 407 (W407R)

Ref Sequence

ENSEMBL: ENSMUSP00000141564 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085992] [ENSMUST00000192369]

Predicted Effect

probably benign
Transcript: ENSMUST00000085992
AA Change: W407R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000083155
Gene: ENSMUSG00000026564
AA Change: W407R

Domain	Start	End	E-Value	Type
low complexity region	6	20	N/A	INTRINSIC
DSPc	133	277	2.45e-30	SMART
low complexity region	339	348	N/A	INTRINSIC
low complexity region	404	425	N/A	INTRINSIC
low complexity region	429	439	N/A	INTRINSIC
low complexity region	618	635	N/A	INTRINSIC
low complexity region	655	666	N/A	INTRINSIC
low complexity region	773	788	N/A	INTRINSIC
coiled coil region	813	839	N/A	INTRINSIC
low complexity region	851	860	N/A	INTRINSIC
low complexity region	936	950	N/A	INTRINSIC
low complexity region	1001	1019	N/A	INTRINSIC
low complexity region	1026	1040	N/A	INTRINSIC
low complexity region	1074	1091	N/A	INTRINSIC
low complexity region	1108	1120	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000192369
AA Change: W407R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000141564
Gene: ENSMUSG00000026564
AA Change: W407R

Domain	Start	End	E-Value	Type
low complexity region	6	20	N/A	INTRINSIC
DSPc	133	277	2.45e-30	SMART
low complexity region	339	348	N/A	INTRINSIC
low complexity region	404	425	N/A	INTRINSIC
low complexity region	429	439	N/A	INTRINSIC
low complexity region	618	635	N/A	INTRINSIC
low complexity region	655	666	N/A	INTRINSIC
low complexity region	773	788	N/A	INTRINSIC
coiled coil region	813	839	N/A	INTRINSIC
low complexity region	851	860	N/A	INTRINSIC
low complexity region	936	950	N/A	INTRINSIC
low complexity region	1001	1019	N/A	INTRINSIC
low complexity region	1026	1040	N/A	INTRINSIC
low complexity region	1074	1091	N/A	INTRINSIC
low complexity region	1108	1120	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.2%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600015I10Rik	T	C	6: 48,931,451	S462P	probably damaging	Het
Ablim1	A	T	19: 57,047,018	S316T	probably damaging	Het
Alox8	C	T	11: 69,186,288	V460I	probably damaging	Het
Arvcf	G	A	16: 18,399,732	A491T	probably damaging	Het
Asnsd1	A	G	1: 53,347,227	S414P	possibly damaging	Het
Btbd7	A	G	12: 102,790,709	L706P	probably damaging	Het
Camk2d	T	A	3: 126,780,456	W171R	probably damaging	Het
Casc3	T	A	11: 98,821,506	S124T	probably benign	Het
Casp8ap2	T	C	4: 32,644,560	V1211A	probably benign	Het
Ccdc182	T	C	11: 88,294,136	V14A	possibly damaging	Het
Ccdc80	A	T	16: 45,122,912	Q795L	probably damaging	Het
Ccdc88a	T	G	11: 29,503,480	S1614R	probably damaging	Het
Clcn6	A	G	4: 148,010,652		probably null	Het
Cubn	A	G	2: 13,308,549	V3070A	probably benign	Het
Dst	G	A	1: 34,166,291	V1025I	possibly damaging	Het
Elk3	T	A	10: 93,265,677	I71F	probably damaging	Het
Flt3	A	T	5: 147,369,490	I276N	probably damaging	Het
Frem1	G	T	4: 82,913,558	T1988K	probably benign	Het
Gm597	A	T	1: 28,778,153	V266D	probably damaging	Het
Golph3l	T	A	3: 95,617,357	D306E	probably benign	Het
Grk2	T	A	19: 4,290,670	I254F	probably damaging	Het
Hgf	C	T	5: 16,576,921	T214I	probably benign	Het
Hoxc5	C	A	15: 103,014,382		probably null	Het
Hsd11b1	T	C	1: 193,240,378	T124A	probably benign	Het
Ipp	A	G	4: 116,515,368	Y198C	probably benign	Het
Ism1	T	A	2: 139,740,127		probably null	Het
Klhl42	A	G	6: 147,091,896	Y122C	possibly damaging	Het
Klk1b21	A	T	7: 44,105,994	K206*	probably null	Het
Lcn11	A	G	2: 25,778,085	K85R	probably benign	Het
Macf1	G	T	4: 123,472,730	A2746E	probably damaging	Het
Matn4	A	G	2: 164,400,653	V175A	probably damaging	Het
Myh2	A	T	11: 67,191,719	N1372Y	probably damaging	Het
Ncl	A	G	1: 86,356,955		probably null	Het
Nudt2	A	G	4: 41,480,255	D46G	probably damaging	Het
Obscn	C	T	11: 59,067,174	D3567N	probably benign	Het
Olfr1245	A	T	2: 89,574,961	M255K	possibly damaging	Het
Olfr346	G	C	2: 36,688,475	V158L	probably benign	Het
Olfr373	G	T	8: 72,100,086	V109F	possibly damaging	Het
Pamr1	T	A	2: 102,634,535	M343K	probably benign	Het
Pcdh15	T	G	10: 74,631,193	S1684A	possibly damaging	Het
Ppm1h	T	A	10: 122,878,528	L324*	probably null	Het
Ppp3r2	T	C	4: 49,681,723	I76V	probably benign	Het
Prkdc	G	A	16: 15,677,009	V748I	probably benign	Het
Prss47	A	G	13: 65,051,777	V96A	probably benign	Het
Rsbn1	C	T	3: 103,914,473	T8I	probably benign	Het
Rsf1	GGCG	GGCGACGGCGGCG	7: 97,579,906		probably benign	Het
Serpinb3d	A	G	1: 107,078,452	V302A	probably benign	Het
Sfrp4	A	T	13: 19,632,326	I177F	probably benign	Het
Sh3bp2	A	G	5: 34,544,225		probably benign	Het
Slc7a12	A	G	3: 14,497,333	T257A	probably damaging	Het
Specc1l	T	C	10: 75,267,591		probably null	Het
Stard9	A	G	2: 120,704,235	T3658A	probably benign	Het
Tctex1d4	A	G	4: 117,128,307	E109G	possibly damaging	Het
Tmem2	G	A	19: 21,844,750	A1170T	possibly damaging	Het
Tmem30c	T	C	16: 57,281,362	T68A	probably damaging	Het
Tnr	A	G	1: 159,852,022	I189V	probably benign	Het
Trrap	A	G	5: 144,853,488	N3586S	possibly damaging	Het
Usp14	T	C	18: 10,024,632	T22A	probably damaging	Het
Vmn1r68	A	G	7: 10,527,991	L60P	probably damaging	Het
Vmn2r108	G	A	17: 20,470,990	H424Y	probably benign	Het
Wdr81	C	A	11: 75,445,962	E1534*	probably null	Het
Zc3h13	A	G	14: 75,330,195	E976G	probably damaging	Het
Zfp128	T	C	7: 12,890,029	L108P	possibly damaging	Het
Zfp644	T	C	5: 106,635,682	I1000V	possibly damaging	Het

Other mutations in Dusp27

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00706:Dusp27	APN	1	166100552	missense	probably benign	0.00
IGL00973:Dusp27	APN	1	166099458	missense	probably benign
IGL01331:Dusp27	APN	1	166108180	missense	probably damaging	1.00
IGL01466:Dusp27	APN	1	166100504	missense	probably damaging	1.00
IGL01572:Dusp27	APN	1	166100372	missense	probably benign	0.18
IGL01906:Dusp27	APN	1	166099523	missense	probably damaging	1.00
IGL01974:Dusp27	APN	1	166100536	nonsense	probably null
IGL02112:Dusp27	APN	1	166099671	nonsense	probably null
IGL02805:Dusp27	APN	1	166099061	missense	probably damaging	1.00
IGL03343:Dusp27	APN	1	166099448	missense	probably benign	0.00
R0116:Dusp27	UTSW	1	166099701	missense	probably benign	0.19
R0367:Dusp27	UTSW	1	166100763	missense	probably benign	0.05
R0499:Dusp27	UTSW	1	166099101	missense	probably benign	0.00
R0542:Dusp27	UTSW	1	166101284	missense	possibly damaging	0.90
R1312:Dusp27	UTSW	1	166099291	missense	possibly damaging	0.46
R1572:Dusp27	UTSW	1	166099455	missense	possibly damaging	0.68
R1598:Dusp27	UTSW	1	166110259	missense	probably benign	0.10
R1858:Dusp27	UTSW	1	166100846	missense	possibly damaging	0.87
R2970:Dusp27	UTSW	1	166099229	missense	probably benign	0.04
R3727:Dusp27	UTSW	1	166099506	missense	probably damaging	1.00
R4041:Dusp27	UTSW	1	166100111	missense	probably benign	0.01
R4245:Dusp27	UTSW	1	166101116	missense	probably damaging	1.00
R4955:Dusp27	UTSW	1	166108092	missense	probably damaging	1.00
R4967:Dusp27	UTSW	1	166127106	missense	probably damaging	1.00
R5040:Dusp27	UTSW	1	166100345	missense	probably benign	0.17
R5342:Dusp27	UTSW	1	166110250	missense	probably benign	0.01
R5467:Dusp27	UTSW	1	166112030	critical splice donor site	probably null
R5742:Dusp27	UTSW	1	166099454	missense	probably benign	0.00
R6222:Dusp27	UTSW	1	166098645	missense	probably benign	0.26
R6239:Dusp27	UTSW	1	166098819	missense	probably damaging	1.00
R6531:Dusp27	UTSW	1	166110046	splice site	probably null
R6586:Dusp27	UTSW	1	166100885	missense	possibly damaging	0.79
R6958:Dusp27	UTSW	1	166107996	missense	probably damaging	1.00
R7006:Dusp27	UTSW	1	166099094	missense	probably benign
R7111:Dusp27	UTSW	1	166127154	missense	possibly damaging	0.66
R7310:Dusp27	UTSW	1	166098731	missense	possibly damaging	0.46
R7312:Dusp27	UTSW	1	166127107	missense	probably damaging	0.99
R7378:Dusp27	UTSW	1	166112063	nonsense	probably null
R7398:Dusp27	UTSW	1	166100475	missense	probably damaging	1.00
R7442:Dusp27	UTSW	1	166101015	missense	probably benign	0.01
R7569:Dusp27	UTSW	1	166108035	missense	probably damaging	1.00
R7920:Dusp27	UTSW	1	166099896	missense	possibly damaging	0.72
R7954:Dusp27	UTSW	1	166099280	missense	probably benign	0.05
R7972:Dusp27	UTSW	1	166099139	missense	probably damaging	1.00
R8186:Dusp27	UTSW	1	166100079	missense	probably damaging	1.00
R8354:Dusp27	UTSW	1	166108133	missense	probably damaging	1.00
R8454:Dusp27	UTSW	1	166108133	missense	probably damaging	1.00
R8535:Dusp27	UTSW	1	166101161	missense	probably benign	0.01
Z1088:Dusp27	UTSW	1	166099283	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAGTCAGAGCGGTATCTTCC -3'
(R):5'- AACCAGTCACTCTTATTGATGACG -3'

Sequencing Primer
(F):5'- CGGTATCTTCCGCGGCG -3'
(R):5'- CAGTCACTCTTATTGATGACGAGGAG -3'

Posted On

2014-08-25