Incidental Mutation 'R1993:Sin3a'
ID223926
Institutional Source Beutler Lab
Gene Symbol Sin3a
Ensembl Gene ENSMUSG00000042557
Gene Nametranscriptional regulator, SIN3A (yeast)
SynonymsSin3, mSin3A
MMRRC Submission 040004-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1993 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location57072040-57128366 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57101199 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 468 (F468L)
Ref Sequence ENSEMBL: ENSMUSP00000126601 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049169] [ENSMUST00000167715] [ENSMUST00000168177] [ENSMUST00000168502] [ENSMUST00000168678]
Predicted Effect probably damaging
Transcript: ENSMUST00000049169
AA Change: F468L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045044
Gene: ENSMUSG00000042557
AA Change: F468L

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
Pfam:PAH 141 187 1.4e-19 PFAM
low complexity region 217 248 N/A INTRINSIC
low complexity region 267 282 N/A INTRINSIC
Pfam:PAH 322 381 1.8e-23 PFAM
Pfam:PAH 478 524 4e-16 PFAM
HDAC_interact 551 651 3.31e-61 SMART
low complexity region 834 847 N/A INTRINSIC
low complexity region 915 930 N/A INTRINSIC
low complexity region 1135 1151 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125333
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165927
Predicted Effect probably damaging
Transcript: ENSMUST00000167715
AA Change: F468L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130641
Gene: ENSMUSG00000042557
AA Change: F468L

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
Pfam:PAH 141 187 1.4e-19 PFAM
low complexity region 217 248 N/A INTRINSIC
low complexity region 267 282 N/A INTRINSIC
Pfam:PAH 322 381 1.8e-23 PFAM
Pfam:PAH 478 524 4e-16 PFAM
HDAC_interact 551 651 3.31e-61 SMART
low complexity region 834 847 N/A INTRINSIC
low complexity region 915 930 N/A INTRINSIC
low complexity region 1135 1151 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168177
AA Change: F468L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130221
Gene: ENSMUSG00000042557
AA Change: F468L

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
Pfam:PAH 142 186 5.3e-22 PFAM
low complexity region 217 248 N/A INTRINSIC
low complexity region 267 282 N/A INTRINSIC
Pfam:PAH 323 380 9.6e-22 PFAM
Pfam:PAH 479 523 8.1e-11 PFAM
HDAC_interact 551 651 3.31e-61 SMART
low complexity region 834 847 N/A INTRINSIC
Pfam:Sin3a_C 887 1190 1.2e-93 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168502
AA Change: F468L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128956
Gene: ENSMUSG00000042557
AA Change: F468L

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
Pfam:PAH 141 187 1.4e-19 PFAM
low complexity region 217 248 N/A INTRINSIC
low complexity region 267 282 N/A INTRINSIC
Pfam:PAH 322 381 1.8e-23 PFAM
Pfam:PAH 478 524 4e-16 PFAM
HDAC_interact 551 651 3.31e-61 SMART
low complexity region 834 847 N/A INTRINSIC
low complexity region 915 930 N/A INTRINSIC
low complexity region 1138 1154 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168678
AA Change: F468L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126601
Gene: ENSMUSG00000042557
AA Change: F468L

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
Pfam:PAH 141 187 1.4e-19 PFAM
low complexity region 217 248 N/A INTRINSIC
low complexity region 267 282 N/A INTRINSIC
Pfam:PAH 322 381 1.8e-23 PFAM
Pfam:PAH 478 524 4e-16 PFAM
HDAC_interact 551 651 3.31e-61 SMART
low complexity region 834 847 N/A INTRINSIC
low complexity region 915 930 N/A INTRINSIC
low complexity region 1135 1151 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcriptional regulatory protein. It contains paired amphipathic helix (PAH) domains, which are important for protein-protein interactions and may mediate repression by the Mad-Max complex. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of this gene results in early embryonic lethality. Homozygous null MEFs display poor cell proliferation, reduced S-phase and increased G2/M fractions, a block in DNA replication, and enhanced apoptosis; however, no increase in chromosomal instability is observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T G 5: 8,821,322 I292S possibly damaging Het
Abcc4 T C 14: 118,526,282 N1047S probably benign Het
Abcc8 G T 7: 46,117,423 probably null Het
Akap9 T A 5: 4,038,520 probably null Het
Alox5 T A 6: 116,415,463 I366F probably damaging Het
Amn A G 12: 111,276,092 N447S probably damaging Het
Ankrd22 A T 19: 34,165,774 M1K probably null Het
Asic1 G T 15: 99,671,884 G29C probably damaging Het
Atxn7l1 A G 12: 33,345,977 N235S probably benign Het
AY358078 T A 14: 51,826,062 D388E probably damaging Het
Bod1l A G 5: 41,817,336 S2212P probably damaging Het
Cacna1e T A 1: 154,477,817 Q423L probably damaging Het
Calu T C 6: 29,366,975 I62T possibly damaging Het
Cars2 A G 8: 11,514,515 V75A probably benign Het
Catsperb T A 12: 101,602,767 N899K possibly damaging Het
Ccdc50 T A 16: 27,409,339 C86* probably null Het
Cdh5 G T 8: 104,137,815 L469F probably damaging Het
Clrn3 A T 7: 135,514,119 D167E probably benign Het
Csmd1 A T 8: 16,346,684 C411S probably damaging Het
Dchs1 A T 7: 105,762,548 S1454T probably benign Het
Ddx20 G A 3: 105,679,344 Q562* probably null Het
Dgkg T G 16: 22,600,594 Y52S probably damaging Het
Dhx58 T C 11: 100,703,490 probably null Het
Dpp6 A T 5: 27,399,006 I145L probably benign Het
Efna2 A T 10: 80,186,877 Y85F possibly damaging Het
Eif3a C T 19: 60,781,516 V127I probably benign Het
Exph5 A T 9: 53,373,635 H672L possibly damaging Het
Fam131b T C 6: 42,320,884 T112A possibly damaging Het
Fam71e2 A T 7: 4,758,018 V565E probably damaging Het
Fcgr1 A T 3: 96,285,868 V271E probably damaging Het
Fgfr4 A G 13: 55,165,902 D508G probably damaging Het
Fndc3b A G 3: 27,419,400 M1172T probably benign Het
Fryl G T 5: 73,108,493 T495K probably damaging Het
Gm5134 A T 10: 75,966,393 I93F probably damaging Het
Gpbar1 G A 1: 74,279,444 G282D possibly damaging Het
Gria2 G A 3: 80,802,357 L10F probably benign Het
Grm7 T C 6: 111,207,808 Y367H probably benign Het
Hils1 T A 11: 94,968,032 V51E probably damaging Het
Hivep1 G A 13: 42,157,493 A1070T probably benign Het
Il33 A G 19: 29,956,904 D155G possibly damaging Het
Kdm6b T C 11: 69,406,303 S408G probably null Het
Kntc1 G A 5: 123,759,099 probably null Het
Kntc1 A G 5: 123,810,811 probably null Het
Ltbp2 T G 12: 84,808,446 probably null Het
Mapk8ip3 G T 17: 24,914,588 L83I probably damaging Het
Meltf C A 16: 31,892,622 Y554* probably null Het
Mov10 A C 3: 104,799,419 F725C probably damaging Het
Ms4a6d A C 19: 11,590,159 L18R probably damaging Het
Naip2 T C 13: 100,162,007 N507S probably benign Het
Nodal A G 10: 61,418,334 Q12R probably benign Het
Npy6r T C 18: 44,276,508 L332P probably damaging Het
Nrxn3 A G 12: 89,260,411 K272R possibly damaging Het
Obox2 G T 7: 15,397,249 K93N probably benign Het
Olfr1136 C T 2: 87,693,433 V150M probably benign Het
Olfr1408 C T 1: 173,130,851 R122H possibly damaging Het
Olfr1466 A G 19: 13,341,814 T19A possibly damaging Het
Olfr575 G T 7: 102,954,746 P285Q probably damaging Het
Pcdh12 T A 18: 38,282,143 D643V possibly damaging Het
Pcsk2 A G 2: 143,687,619 D112G probably benign Het
Pms1 A G 1: 53,195,015 S781P probably benign Het
Prtg A G 9: 72,844,896 D188G probably benign Het
Psg21 A T 7: 18,654,770 N132K probably benign Het
Psip1 A G 4: 83,482,532 V25A probably damaging Het
Psmd13 T A 7: 140,898,194 I319N probably damaging Het
Ptges2 A G 2: 32,400,092 T173A probably benign Het
Ptprm G A 17: 66,747,160 R975W probably damaging Het
Rdh1 A G 10: 127,765,345 D254G probably benign Het
Rnf138 T G 18: 21,024,483 N212K probably damaging Het
Serpine2 A G 1: 79,821,442 S32P probably damaging Het
Serpini1 G T 3: 75,614,664 W154L probably damaging Het
Sf3a1 C A 11: 4,179,177 Q713K possibly damaging Het
Sgo2b A T 8: 63,926,833 H988Q probably benign Het
Slamf6 A T 1: 171,934,209 I66F possibly damaging Het
Slc22a28 A T 19: 8,117,124 C178S possibly damaging Het
Slc35a1 A C 4: 34,675,181 V119G probably damaging Het
Slc39a12 A T 2: 14,434,219 H428L probably damaging Het
Speer2 A G 16: 69,858,077 S167P probably benign Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Spsb2 T C 6: 124,809,366 probably null Het
Stam2 A T 2: 52,703,156 Y341* probably null Het
Sv2b G A 7: 75,206,341 A67V probably benign Het
Svep1 A G 4: 58,064,170 probably null Het
Syt15 A T 14: 34,223,012 Q172L probably benign Het
T G A 17: 8,441,802 S415N probably benign Het
Tep1 A G 14: 50,824,184 F2625S possibly damaging Het
Tex14 T C 11: 87,536,755 V11A possibly damaging Het
Tiam2 A T 17: 3,415,126 R377* probably null Het
Tirap A G 9: 35,191,016 probably null Het
Tm4sf20 T C 1: 82,760,217 T118A probably benign Het
Trank1 A T 9: 111,378,832 Q1715L probably benign Het
Trpm2 C T 10: 77,947,989 V217M probably damaging Het
Ubap1l G A 9: 65,371,796 E126K possibly damaging Het
Urgcp G T 11: 5,716,526 P604Q probably damaging Het
Vmn1r63 A G 7: 5,803,255 V126A probably benign Het
Vmn2r90 T C 17: 17,713,263 C362R probably damaging Het
Vmn2r96 A G 17: 18,583,876 I271V probably damaging Het
Vps13a A T 19: 16,722,458 I740K probably benign Het
Vps13c A G 9: 67,975,856 T3562A probably damaging Het
Wdr91 T A 6: 34,892,362 H409L probably damaging Het
Wnt7a T A 6: 91,365,956 T315S possibly damaging Het
Zfp616 A G 11: 74,084,969 H688R probably benign Het
Zfp763 A T 17: 33,018,439 H577Q probably damaging Het
Zfp808 G A 13: 62,172,907 S650N probably benign Het
Zfp977 A T 7: 42,579,985 M372K probably benign Het
Other mutations in Sin3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Sin3a APN 9 57097901 missense probably damaging 1.00
IGL00836:Sin3a APN 9 57107345 splice site probably null
IGL00913:Sin3a APN 9 57098118 missense probably benign 0.01
IGL01721:Sin3a APN 9 57095325 missense probably damaging 1.00
IGL01964:Sin3a APN 9 57107347 splice site probably benign
IGL02333:Sin3a APN 9 57107559 missense possibly damaging 0.86
IGL02673:Sin3a APN 9 57107441 missense probably damaging 0.99
Delicate UTSW 9 57103929 missense probably damaging 1.00
IGL03014:Sin3a UTSW 9 57095255 intron probably benign
PIT4519001:Sin3a UTSW 9 57095456 missense possibly damaging 0.86
R0024:Sin3a UTSW 9 57118253 intron probably benign
R0309:Sin3a UTSW 9 57110912 missense probably benign 0.00
R0511:Sin3a UTSW 9 57096895 nonsense probably null
R1205:Sin3a UTSW 9 57119175 missense probably damaging 1.00
R1365:Sin3a UTSW 9 57125203 nonsense probably null
R1496:Sin3a UTSW 9 57119158 missense possibly damaging 0.77
R1544:Sin3a UTSW 9 57103997 splice site probably benign
R1958:Sin3a UTSW 9 57105609 missense probably damaging 1.00
R2037:Sin3a UTSW 9 57096825 missense probably benign 0.14
R2065:Sin3a UTSW 9 57110800 missense possibly damaging 0.93
R2079:Sin3a UTSW 9 57089523 missense probably benign
R2193:Sin3a UTSW 9 57117477 missense possibly damaging 0.93
R3004:Sin3a UTSW 9 57096834 nonsense probably null
R3929:Sin3a UTSW 9 57118137 missense probably damaging 0.98
R4326:Sin3a UTSW 9 57095358 missense probably damaging 1.00
R4327:Sin3a UTSW 9 57095358 missense probably damaging 1.00
R4329:Sin3a UTSW 9 57095358 missense probably damaging 1.00
R4765:Sin3a UTSW 9 57096803 missense probably benign 0.14
R4806:Sin3a UTSW 9 57086742 missense probably damaging 0.99
R4979:Sin3a UTSW 9 57118076 missense probably damaging 1.00
R5018:Sin3a UTSW 9 57110891 missense probably benign 0.00
R5368:Sin3a UTSW 9 57110800 missense possibly damaging 0.93
R5379:Sin3a UTSW 9 57110988 missense probably benign 0.10
R5391:Sin3a UTSW 9 57105673 missense probably damaging 1.00
R5395:Sin3a UTSW 9 57105673 missense probably damaging 1.00
R5519:Sin3a UTSW 9 57118173 critical splice donor site probably null
R5927:Sin3a UTSW 9 57111111 missense probably damaging 1.00
R5987:Sin3a UTSW 9 57127200 missense possibly damaging 0.75
R6083:Sin3a UTSW 9 57107540 missense probably damaging 1.00
R6161:Sin3a UTSW 9 57095424 missense possibly damaging 0.48
R6196:Sin3a UTSW 9 57103929 missense probably damaging 1.00
R6374:Sin3a UTSW 9 57117481 missense probably benign
R6456:Sin3a UTSW 9 57113701 missense possibly damaging 0.79
R6815:Sin3a UTSW 9 57117540 missense probably benign 0.02
R6900:Sin3a UTSW 9 57107574 missense probably damaging 1.00
R7051:Sin3a UTSW 9 57103934 missense probably damaging 1.00
R7081:Sin3a UTSW 9 57094471 missense probably null 1.00
R7285:Sin3a UTSW 9 57127299 missense possibly damaging 0.57
R7462:Sin3a UTSW 9 57095525 missense probably benign 0.00
R7538:Sin3a UTSW 9 57103926 missense possibly damaging 0.95
RF017:Sin3a UTSW 9 57127326 missense possibly damaging 0.90
X0026:Sin3a UTSW 9 57125192 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CACTTTAAGCATTGTTCACAGGAG -3'
(R):5'- CACGTAGGCTACATGTAGTGC -3'

Sequencing Primer
(F):5'- TTAAGCATTGTTCACAGGAGAGAATG -3'
(R):5'- GGCTACATGTAGTGCCACTTAAG -3'
Posted On2014-08-25