Incidental Mutation 'R1993:Vps13c'
ID223930
Institutional Source Beutler Lab
Gene Symbol Vps13c
Ensembl Gene ENSMUSG00000035284
Gene Namevacuolar protein sorting 13C
SynonymsC230055H22Rik
MMRRC Submission 040004-MU
Accession Numbers

Genbank: NM_177184; MGI: 2444207

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1993 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location67840396-67995638 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 67975856 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 3562 (T3562A)
Ref Sequence ENSEMBL: ENSMUSP00000077040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077879]
Predicted Effect probably damaging
Transcript: ENSMUST00000077879
AA Change: T3562A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077040
Gene: ENSMUSG00000035284
AA Change: T3562A

DomainStartEndE-ValueType
Pfam:Chorein_N 3 117 1.3e-39 PFAM
low complexity region 151 165 N/A INTRINSIC
Pfam:VPS13 182 414 7.9e-70 PFAM
coiled coil region 422 443 N/A INTRINSIC
low complexity region 479 490 N/A INTRINSIC
Pfam:VPS13_mid_rpt 611 832 7.8e-71 PFAM
low complexity region 867 885 N/A INTRINSIC
low complexity region 1020 1036 N/A INTRINSIC
low complexity region 1112 1123 N/A INTRINSIC
Pfam:VPS13_mid_rpt 1172 1369 2.1e-14 PFAM
low complexity region 1552 1573 N/A INTRINSIC
Pfam:VPS13_mid_rpt 1685 1883 2.8e-13 PFAM
Blast:INB 2128 2403 2e-48 BLAST
Pfam:SHR-BD 2759 3013 9.9e-32 PFAM
Pfam:VPS13_C 3317 3495 5.7e-65 PFAM
Pfam:ATG_C 3498 3588 7.9e-12 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000213168
AA Change: T695A
Predicted Effect unknown
Transcript: ENSMUST00000215524
AA Change: T14A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216856
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vacuolar protein sorting-associated 13 gene family. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2010]
Allele List at MGI

All alleles(13) : Targeted, other(2) Gene trapped(11)

Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T G 5: 8,821,322 I292S possibly damaging Het
Abcc4 T C 14: 118,526,282 N1047S probably benign Het
Abcc8 G T 7: 46,117,423 probably null Het
Akap9 T A 5: 4,038,520 probably null Het
Alox5 T A 6: 116,415,463 I366F probably damaging Het
Amn A G 12: 111,276,092 N447S probably damaging Het
Ankrd22 A T 19: 34,165,774 M1K probably null Het
Asic1 G T 15: 99,671,884 G29C probably damaging Het
Atxn7l1 A G 12: 33,345,977 N235S probably benign Het
AY358078 T A 14: 51,826,062 D388E probably damaging Het
Bod1l A G 5: 41,817,336 S2212P probably damaging Het
Cacna1e T A 1: 154,477,817 Q423L probably damaging Het
Calu T C 6: 29,366,975 I62T possibly damaging Het
Cars2 A G 8: 11,514,515 V75A probably benign Het
Catsperb T A 12: 101,602,767 N899K possibly damaging Het
Ccdc50 T A 16: 27,409,339 C86* probably null Het
Cdh5 G T 8: 104,137,815 L469F probably damaging Het
Clrn3 A T 7: 135,514,119 D167E probably benign Het
Csmd1 A T 8: 16,346,684 C411S probably damaging Het
Dchs1 A T 7: 105,762,548 S1454T probably benign Het
Ddx20 G A 3: 105,679,344 Q562* probably null Het
Dgkg T G 16: 22,600,594 Y52S probably damaging Het
Dhx58 T C 11: 100,703,490 probably null Het
Dpp6 A T 5: 27,399,006 I145L probably benign Het
Efna2 A T 10: 80,186,877 Y85F possibly damaging Het
Eif3a C T 19: 60,781,516 V127I probably benign Het
Exph5 A T 9: 53,373,635 H672L possibly damaging Het
Fam131b T C 6: 42,320,884 T112A possibly damaging Het
Fam71e2 A T 7: 4,758,018 V565E probably damaging Het
Fcgr1 A T 3: 96,285,868 V271E probably damaging Het
Fgfr4 A G 13: 55,165,902 D508G probably damaging Het
Fndc3b A G 3: 27,419,400 M1172T probably benign Het
Fryl G T 5: 73,108,493 T495K probably damaging Het
Gm5134 A T 10: 75,966,393 I93F probably damaging Het
Gpbar1 G A 1: 74,279,444 G282D possibly damaging Het
Gria2 G A 3: 80,802,357 L10F probably benign Het
Grm7 T C 6: 111,207,808 Y367H probably benign Het
Hils1 T A 11: 94,968,032 V51E probably damaging Het
Hivep1 G A 13: 42,157,493 A1070T probably benign Het
Il33 A G 19: 29,956,904 D155G possibly damaging Het
Kdm6b T C 11: 69,406,303 S408G probably null Het
Kntc1 G A 5: 123,759,099 probably null Het
Kntc1 A G 5: 123,810,811 probably null Het
Ltbp2 T G 12: 84,808,446 probably null Het
Mapk8ip3 G T 17: 24,914,588 L83I probably damaging Het
Meltf C A 16: 31,892,622 Y554* probably null Het
Mov10 A C 3: 104,799,419 F725C probably damaging Het
Ms4a6d A C 19: 11,590,159 L18R probably damaging Het
Naip2 T C 13: 100,162,007 N507S probably benign Het
Nodal A G 10: 61,418,334 Q12R probably benign Het
Npy6r T C 18: 44,276,508 L332P probably damaging Het
Nrxn3 A G 12: 89,260,411 K272R possibly damaging Het
Obox2 G T 7: 15,397,249 K93N probably benign Het
Olfr1136 C T 2: 87,693,433 V150M probably benign Het
Olfr1408 C T 1: 173,130,851 R122H possibly damaging Het
Olfr1466 A G 19: 13,341,814 T19A possibly damaging Het
Olfr575 G T 7: 102,954,746 P285Q probably damaging Het
Pcdh12 T A 18: 38,282,143 D643V possibly damaging Het
Pcsk2 A G 2: 143,687,619 D112G probably benign Het
Pms1 A G 1: 53,195,015 S781P probably benign Het
Prtg A G 9: 72,844,896 D188G probably benign Het
Psg21 A T 7: 18,654,770 N132K probably benign Het
Psip1 A G 4: 83,482,532 V25A probably damaging Het
Psmd13 T A 7: 140,898,194 I319N probably damaging Het
Ptges2 A G 2: 32,400,092 T173A probably benign Het
Ptprm G A 17: 66,747,160 R975W probably damaging Het
Rdh1 A G 10: 127,765,345 D254G probably benign Het
Rnf138 T G 18: 21,024,483 N212K probably damaging Het
Serpine2 A G 1: 79,821,442 S32P probably damaging Het
Serpini1 G T 3: 75,614,664 W154L probably damaging Het
Sf3a1 C A 11: 4,179,177 Q713K possibly damaging Het
Sgo2b A T 8: 63,926,833 H988Q probably benign Het
Sin3a T C 9: 57,101,199 F468L probably damaging Het
Slamf6 A T 1: 171,934,209 I66F possibly damaging Het
Slc22a28 A T 19: 8,117,124 C178S possibly damaging Het
Slc35a1 A C 4: 34,675,181 V119G probably damaging Het
Slc39a12 A T 2: 14,434,219 H428L probably damaging Het
Speer2 A G 16: 69,858,077 S167P probably benign Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Spsb2 T C 6: 124,809,366 probably null Het
Stam2 A T 2: 52,703,156 Y341* probably null Het
Sv2b G A 7: 75,206,341 A67V probably benign Het
Svep1 A G 4: 58,064,170 probably null Het
Syt15 A T 14: 34,223,012 Q172L probably benign Het
T G A 17: 8,441,802 S415N probably benign Het
Tep1 A G 14: 50,824,184 F2625S possibly damaging Het
Tex14 T C 11: 87,536,755 V11A possibly damaging Het
Tiam2 A T 17: 3,415,126 R377* probably null Het
Tirap A G 9: 35,191,016 probably null Het
Tm4sf20 T C 1: 82,760,217 T118A probably benign Het
Trank1 A T 9: 111,378,832 Q1715L probably benign Het
Trpm2 C T 10: 77,947,989 V217M probably damaging Het
Ubap1l G A 9: 65,371,796 E126K possibly damaging Het
Urgcp G T 11: 5,716,526 P604Q probably damaging Het
Vmn1r63 A G 7: 5,803,255 V126A probably benign Het
Vmn2r90 T C 17: 17,713,263 C362R probably damaging Het
Vmn2r96 A G 17: 18,583,876 I271V probably damaging Het
Vps13a A T 19: 16,722,458 I740K probably benign Het
Wdr91 T A 6: 34,892,362 H409L probably damaging Het
Wnt7a T A 6: 91,365,956 T315S possibly damaging Het
Zfp616 A G 11: 74,084,969 H688R probably benign Het
Zfp763 A T 17: 33,018,439 H577Q probably damaging Het
Zfp808 G A 13: 62,172,907 S650N probably benign Het
Zfp977 A T 7: 42,579,985 M372K probably benign Het
Other mutations in Vps13c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Vps13c APN 9 67945999 missense probably benign 0.20
IGL00336:Vps13c APN 9 67945942 missense probably benign 0.01
IGL00418:Vps13c APN 9 67876262 missense probably damaging 1.00
IGL00481:Vps13c APN 9 67860865 missense probably damaging 1.00
IGL00491:Vps13c APN 9 67893136 missense probably damaging 1.00
IGL00558:Vps13c APN 9 67937857 missense possibly damaging 0.52
IGL00811:Vps13c APN 9 67948181 missense probably damaging 0.99
IGL01011:Vps13c APN 9 67926955 missense probably damaging 0.98
IGL01094:Vps13c APN 9 67886284 missense probably damaging 1.00
IGL01330:Vps13c APN 9 67964108 missense probably damaging 1.00
IGL01402:Vps13c APN 9 67913204 critical splice acceptor site probably null
IGL01404:Vps13c APN 9 67913204 critical splice acceptor site probably null
IGL01470:Vps13c APN 9 67912927 splice site probably benign
IGL01615:Vps13c APN 9 67955781 missense probably benign 0.01
IGL01694:Vps13c APN 9 67895349 missense probably damaging 1.00
IGL01752:Vps13c APN 9 67948228 missense probably damaging 1.00
IGL01810:Vps13c APN 9 67955780 missense probably benign
IGL01954:Vps13c APN 9 67969298 missense probably damaging 0.98
IGL01978:Vps13c APN 9 67930643 missense probably benign 0.03
IGL01998:Vps13c APN 9 67955068 splice site probably null
IGL02201:Vps13c APN 9 67967136 missense probably damaging 1.00
IGL02205:Vps13c APN 9 67883454 missense probably damaging 1.00
IGL02303:Vps13c APN 9 67945481 splice site probably benign
IGL02322:Vps13c APN 9 67937901 missense probably benign 0.02
IGL02456:Vps13c APN 9 67952976 missense probably damaging 1.00
IGL02474:Vps13c APN 9 67937876 missense probably benign 0.00
IGL02547:Vps13c APN 9 67908019 missense possibly damaging 0.83
IGL02640:Vps13c APN 9 67886248 splice site probably benign
IGL02673:Vps13c APN 9 67878098 missense probably damaging 1.00
IGL02721:Vps13c APN 9 67964149 splice site probably benign
IGL02834:Vps13c APN 9 67937855 missense probably benign
IGL02838:Vps13c APN 9 67975851 missense probably damaging 1.00
IGL03136:Vps13c APN 9 67950310 missense probably damaging 1.00
IGL03137:Vps13c APN 9 67890380 missense probably damaging 1.00
IGL03214:Vps13c APN 9 67897195 missense probably null 0.81
IGL03240:Vps13c APN 9 67955047 missense probably benign
IGL03303:Vps13c APN 9 67934504 missense probably benign 0.27
IGL03336:Vps13c APN 9 67951642 missense possibly damaging 0.76
IGL03366:Vps13c APN 9 67946026 missense probably benign 0.00
3-1:Vps13c UTSW 9 67936373 missense probably benign 0.00
IGL02991:Vps13c UTSW 9 67913877 missense probably damaging 1.00
PIT4802001:Vps13c UTSW 9 67937786 missense probably damaging 1.00
R0008:Vps13c UTSW 9 67919262 missense probably benign
R0206:Vps13c UTSW 9 67939162 splice site probably benign
R0288:Vps13c UTSW 9 67927366 missense probably damaging 0.99
R0324:Vps13c UTSW 9 67964309 missense possibly damaging 0.95
R0347:Vps13c UTSW 9 67910233 missense possibly damaging 0.93
R0374:Vps13c UTSW 9 67886246 splice site probably benign
R0388:Vps13c UTSW 9 67922915 splice site probably benign
R0409:Vps13c UTSW 9 67951644 missense probably benign 0.00
R0440:Vps13c UTSW 9 67972861 missense probably damaging 1.00
R0513:Vps13c UTSW 9 67930735 missense probably benign 0.02
R0520:Vps13c UTSW 9 67945851 missense possibly damaging 0.88
R0569:Vps13c UTSW 9 67973719 missense probably damaging 0.98
R0601:Vps13c UTSW 9 67927472 missense probably benign 0.12
R0659:Vps13c UTSW 9 67920935 missense probably benign 0.11
R0667:Vps13c UTSW 9 67951573 nonsense probably null
R0670:Vps13c UTSW 9 67925857 missense probably benign 0.35
R0698:Vps13c UTSW 9 67889723 missense probably benign 0.45
R0729:Vps13c UTSW 9 67961649 missense probably damaging 1.00
R0781:Vps13c UTSW 9 67972003 missense probably damaging 1.00
R0811:Vps13c UTSW 9 67934476 missense probably benign 0.06
R0812:Vps13c UTSW 9 67934476 missense probably benign 0.06
R0839:Vps13c UTSW 9 67898738 missense probably benign
R1373:Vps13c UTSW 9 67927511 missense probably damaging 0.99
R1396:Vps13c UTSW 9 67955022 missense probably benign 0.00
R1499:Vps13c UTSW 9 67957505 missense probably benign 0.00
R1556:Vps13c UTSW 9 67930711 missense probably damaging 0.98
R1560:Vps13c UTSW 9 67936463 critical splice donor site probably null
R1584:Vps13c UTSW 9 67893112 missense possibly damaging 0.74
R1654:Vps13c UTSW 9 67951687 missense probably damaging 1.00
R1674:Vps13c UTSW 9 67853703 nonsense probably null
R1676:Vps13c UTSW 9 67926962 missense probably benign 0.20
R1695:Vps13c UTSW 9 67972075 nonsense probably null
R1710:Vps13c UTSW 9 67911529 missense probably benign 0.00
R1769:Vps13c UTSW 9 67965721 missense probably benign 0.00
R1775:Vps13c UTSW 9 67881447 missense probably damaging 1.00
R1795:Vps13c UTSW 9 67893985 nonsense probably null
R1799:Vps13c UTSW 9 67944117 missense probably damaging 0.98
R1835:Vps13c UTSW 9 67993013 missense probably benign 0.08
R1848:Vps13c UTSW 9 67936340 missense probably benign
R1903:Vps13c UTSW 9 67894052 missense probably damaging 1.00
R1944:Vps13c UTSW 9 67886276 missense probably damaging 1.00
R1945:Vps13c UTSW 9 67886276 missense probably damaging 1.00
R1951:Vps13c UTSW 9 67973759 critical splice donor site probably null
R2023:Vps13c UTSW 9 67936285 splice site probably benign
R2059:Vps13c UTSW 9 67860833 missense probably damaging 1.00
R2086:Vps13c UTSW 9 67950289 missense probably benign 0.29
R2120:Vps13c UTSW 9 67919334 missense possibly damaging 0.92
R2249:Vps13c UTSW 9 67988053 critical splice donor site probably null
R2257:Vps13c UTSW 9 67952946 missense possibly damaging 0.87
R2258:Vps13c UTSW 9 67953860 missense probably benign 0.01
R2259:Vps13c UTSW 9 67953860 missense probably benign 0.01
R2260:Vps13c UTSW 9 67953860 missense probably benign 0.01
R2265:Vps13c UTSW 9 67920947 missense possibly damaging 0.82
R2266:Vps13c UTSW 9 67920947 missense possibly damaging 0.82
R2269:Vps13c UTSW 9 67920947 missense possibly damaging 0.82
R2278:Vps13c UTSW 9 67939072 missense probably benign
R2306:Vps13c UTSW 9 67987993 missense probably damaging 0.99
R2327:Vps13c UTSW 9 67913820 missense probably damaging 0.98
R2349:Vps13c UTSW 9 67957526 missense possibly damaging 0.89
R2483:Vps13c UTSW 9 67975907 critical splice donor site probably null
R3031:Vps13c UTSW 9 67923770 missense probably benign 0.00
R3623:Vps13c UTSW 9 67975907 critical splice donor site probably null
R3870:Vps13c UTSW 9 67884726 missense probably benign 0.00
R4173:Vps13c UTSW 9 67936313 missense probably benign 0.00
R4445:Vps13c UTSW 9 67982495 splice site probably null
R4491:Vps13c UTSW 9 67910193 missense probably benign
R4505:Vps13c UTSW 9 67939034 missense probably benign 0.02
R4574:Vps13c UTSW 9 67951683 missense probably damaging 1.00
R4691:Vps13c UTSW 9 67952935 missense possibly damaging 0.95
R4766:Vps13c UTSW 9 67878224 intron probably null
R4771:Vps13c UTSW 9 67929539 missense probably benign
R4801:Vps13c UTSW 9 67964282 missense probably damaging 1.00
R4802:Vps13c UTSW 9 67964282 missense probably damaging 1.00
R4962:Vps13c UTSW 9 67873891 missense probably damaging 1.00
R4995:Vps13c UTSW 9 67919321 missense probably benign 0.00
R5010:Vps13c UTSW 9 67916379 missense probably benign 0.19
R5183:Vps13c UTSW 9 67908052 missense probably damaging 1.00
R5226:Vps13c UTSW 9 67945553 missense probably benign 0.17
R5297:Vps13c UTSW 9 67878131 missense probably damaging 1.00
R5456:Vps13c UTSW 9 67927447 missense possibly damaging 0.53
R5494:Vps13c UTSW 9 67948146 missense probably benign 0.00
R5521:Vps13c UTSW 9 67951439 missense probably benign 0.08
R5524:Vps13c UTSW 9 67957556 missense probably damaging 1.00
R5685:Vps13c UTSW 9 67963173 missense possibly damaging 0.64
R5731:Vps13c UTSW 9 67895379 missense probably damaging 1.00
R5812:Vps13c UTSW 9 67982495 splice site probably benign
R5867:Vps13c UTSW 9 67982622 splice site probably null
R5893:Vps13c UTSW 9 67902839 critical splice acceptor site probably null
R5902:Vps13c UTSW 9 67934447 missense probably benign 0.00
R5957:Vps13c UTSW 9 67954971 missense probably damaging 1.00
R6076:Vps13c UTSW 9 67911602 missense probably damaging 1.00
R6187:Vps13c UTSW 9 67915657 missense probably damaging 1.00
R6268:Vps13c UTSW 9 67951449 missense probably benign 0.10
R6547:Vps13c UTSW 9 67973365 missense probably damaging 1.00
R6716:Vps13c UTSW 9 67951467 missense probably benign 0.00
R6837:Vps13c UTSW 9 67910222 missense probably benign
R6919:Vps13c UTSW 9 67927452 missense probably damaging 0.97
R7039:Vps13c UTSW 9 67937763 missense probably damaging 1.00
R7058:Vps13c UTSW 9 67923828 missense probably benign 0.39
R7082:Vps13c UTSW 9 67883453 missense probably damaging 1.00
R7195:Vps13c UTSW 9 67945825 missense possibly damaging 0.95
R7244:Vps13c UTSW 9 67889804 missense probably benign 0.00
R7300:Vps13c UTSW 9 67940544 missense probably benign 0.20
R7314:Vps13c UTSW 9 67943340 intron probably null
R7352:Vps13c UTSW 9 67840446 missense possibly damaging 0.94
R7368:Vps13c UTSW 9 67914073 missense probably benign 0.23
R7411:Vps13c UTSW 9 67972001 missense probably damaging 0.98
R7497:Vps13c UTSW 9 67840479 missense probably damaging 1.00
R7516:Vps13c UTSW 9 67955007 missense possibly damaging 0.89
R7638:Vps13c UTSW 9 67945509 missense probably damaging 1.00
R7732:Vps13c UTSW 9 67940516 missense probably damaging 0.97
U24488:Vps13c UTSW 9 67905916 missense probably benign 0.13
X0021:Vps13c UTSW 9 67937781 missense probably damaging 0.99
X0058:Vps13c UTSW 9 67927419 missense probably damaging 1.00
X0065:Vps13c UTSW 9 67873863 missense probably damaging 1.00
Z1088:Vps13c UTSW 9 67913975 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGAGAGCAACCATGTCATCAC -3'
(R):5'- ACGAACGGGGCTTTAAGACTC -3'

Sequencing Primer
(F):5'- TGAAATGTAGCGTCCCCAG -3'
(R):5'- CGAACGGGGCTTTAAGACTCATTTC -3'
Posted On2014-08-25