Incidental Mutation 'R2021:Or4a72'
ID 223934
Institutional Source Beutler Lab
Gene Symbol Or4a72
Ensembl Gene ENSMUSG00000111456
Gene Name olfactory receptor family 4 subfamily A member 72
Synonyms GA_x6K02T2Q125-51020951-51020028, MOR231-12, Olfr1245
MMRRC Submission 040030-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.205) question?
Stock # R2021 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 89405056-89406117 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 89405305 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 255 (M255K)
Gene Model predicted gene model for transcript(s): [ENSMUST00000214870] [ENSMUST00000217402]
AlphaFold A0A1L1SQJ6
Predicted Effect possibly damaging
Transcript: ENSMUST00000099766
AA Change: M255K

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097354
Gene: ENSMUSG00000100601
AA Change: M255K

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 6e-49 PFAM
Pfam:7tm_1 39 285 2.8e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000099773
AA Change: M255K

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097361
Gene: ENSMUSG00000075083
AA Change: M255K

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 3.2e-48 PFAM
Pfam:7tm_1 39 285 3e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214870
AA Change: M255K

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217402
AA Change: M255K

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 A T 19: 57,035,450 (GRCm39) S316T probably damaging Het
Alox8 C T 11: 69,077,114 (GRCm39) V460I probably damaging Het
Aoc1l2 T C 6: 48,908,385 (GRCm39) S462P probably damaging Het
Arvcf G A 16: 18,218,482 (GRCm39) A491T probably damaging Het
Asnsd1 A G 1: 53,386,386 (GRCm39) S414P possibly damaging Het
Btbd7 A G 12: 102,756,968 (GRCm39) L706P probably damaging Het
Camk2d T A 3: 126,574,105 (GRCm39) W171R probably damaging Het
Casc3 T A 11: 98,712,332 (GRCm39) S124T probably benign Het
Casp8ap2 T C 4: 32,644,560 (GRCm39) V1211A probably benign Het
Ccdc182 T C 11: 88,184,962 (GRCm39) V14A possibly damaging Het
Ccdc80 A T 16: 44,943,275 (GRCm39) Q795L probably damaging Het
Ccdc88a T G 11: 29,453,480 (GRCm39) S1614R probably damaging Het
Cemip2 G A 19: 21,822,114 (GRCm39) A1170T possibly damaging Het
Clcn6 A G 4: 148,095,109 (GRCm39) probably null Het
Cubn A G 2: 13,313,360 (GRCm39) V3070A probably benign Het
Dst G A 1: 34,205,372 (GRCm39) V1025I possibly damaging Het
Dynlt4 A G 4: 116,985,504 (GRCm39) E109G possibly damaging Het
Elk3 T A 10: 93,101,539 (GRCm39) I71F probably damaging Het
Flt3 A T 5: 147,306,300 (GRCm39) I276N probably damaging Het
Frem1 G T 4: 82,831,795 (GRCm39) T1988K probably benign Het
Golph3l T A 3: 95,524,668 (GRCm39) D306E probably benign Het
Grk2 T A 19: 4,340,698 (GRCm39) I254F probably damaging Het
Hgf C T 5: 16,781,919 (GRCm39) T214I probably benign Het
Hoxc5 C A 15: 102,922,814 (GRCm39) probably null Het
Hsd11b1 T C 1: 192,922,686 (GRCm39) T124A probably benign Het
Ipp A G 4: 116,372,565 (GRCm39) Y198C probably benign Het
Ism1 T A 2: 139,582,047 (GRCm39) probably null Het
Klhl42 A G 6: 146,993,394 (GRCm39) Y122C possibly damaging Het
Klk1b21 A T 7: 43,755,418 (GRCm39) K206* probably null Het
Lcn11 A G 2: 25,668,097 (GRCm39) K85R probably benign Het
Macf1 G T 4: 123,366,523 (GRCm39) A2746E probably damaging Het
Matn4 A G 2: 164,242,573 (GRCm39) V175A probably damaging Het
Myh2 A T 11: 67,082,545 (GRCm39) N1372Y probably damaging Het
Ncl A G 1: 86,284,677 (GRCm39) probably null Het
Nudt2 A G 4: 41,480,255 (GRCm39) D46G probably damaging Het
Obscn C T 11: 58,958,000 (GRCm39) D3567N probably benign Het
Or1j17 G C 2: 36,578,487 (GRCm39) V158L probably benign Het
Or2z9 G T 8: 72,853,930 (GRCm39) V109F possibly damaging Het
Pamr1 T A 2: 102,464,880 (GRCm39) M343K probably benign Het
Pcdh15 T G 10: 74,467,025 (GRCm39) S1684A possibly damaging Het
Ppm1h T A 10: 122,714,433 (GRCm39) L324* probably null Het
Ppp3r2 T C 4: 49,681,723 (GRCm39) I76V probably benign Het
Prkdc G A 16: 15,494,873 (GRCm39) V748I probably benign Het
Prss47 A G 13: 65,199,591 (GRCm39) V96A probably benign Het
Rsbn1 C T 3: 103,821,789 (GRCm39) T8I probably benign Het
Rsf1 GGCG GGCGACGGCGGCG 7: 97,229,113 (GRCm39) probably benign Het
Serpinb3d A G 1: 107,006,182 (GRCm39) V302A probably benign Het
Sfrp4 A T 13: 19,816,496 (GRCm39) I177F probably benign Het
Sh3bp2 A G 5: 34,701,569 (GRCm39) probably benign Het
Slc7a12 A G 3: 14,562,393 (GRCm39) T257A probably damaging Het
Spata31e5 A T 1: 28,817,234 (GRCm39) V266D probably damaging Het
Specc1l T C 10: 75,103,425 (GRCm39) probably null Het
Stard9 A G 2: 120,534,716 (GRCm39) T3658A probably benign Het
Styxl2 A T 1: 165,928,392 (GRCm39) W407R probably benign Het
Tmem30c T C 16: 57,101,725 (GRCm39) T68A probably damaging Het
Tnr A G 1: 159,679,592 (GRCm39) I189V probably benign Het
Trrap A G 5: 144,790,298 (GRCm39) N3586S possibly damaging Het
Usp14 T C 18: 10,024,632 (GRCm39) T22A probably damaging Het
Vmn1r68 A G 7: 10,261,918 (GRCm39) L60P probably damaging Het
Vmn2r108 G A 17: 20,691,252 (GRCm39) H424Y probably benign Het
Wdr81 C A 11: 75,336,788 (GRCm39) E1534* probably null Het
Zc3h13 A G 14: 75,567,635 (GRCm39) E976G probably damaging Het
Zfp128 T C 7: 12,623,956 (GRCm39) L108P possibly damaging Het
Zfp644 T C 5: 106,783,548 (GRCm39) I1000V possibly damaging Het
Other mutations in Or4a72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Or4a72 APN 2 89,405,767 (GRCm39) missense possibly damaging 0.68
IGL01690:Or4a72 APN 2 89,405,557 (GRCm39) missense probably benign 0.09
IGL02334:Or4a72 APN 2 89,405,668 (GRCm39) missense possibly damaging 0.95
IGL02435:Or4a72 APN 2 89,405,890 (GRCm39) missense probably damaging 0.99
IGL02793:Or4a72 APN 2 89,405,896 (GRCm39) missense probably damaging 1.00
IGL02875:Or4a72 APN 2 89,405,896 (GRCm39) missense probably damaging 1.00
IGL03218:Or4a72 APN 2 89,405,935 (GRCm39) missense probably benign 0.09
IGL03392:Or4a72 APN 2 89,405,593 (GRCm39) missense probably damaging 0.96
H8786:Or4a72 UTSW 2 89,405,623 (GRCm39) missense probably damaging 1.00
I0000:Or4a72 UTSW 2 89,405,497 (GRCm39) missense probably damaging 1.00
R0044:Or4a72 UTSW 2 89,405,974 (GRCm39) missense possibly damaging 0.68
R0190:Or4a72 UTSW 2 89,405,302 (GRCm39) missense probably damaging 0.98
R1585:Or4a72 UTSW 2 89,405,746 (GRCm39) missense possibly damaging 0.89
R1902:Or4a72 UTSW 2 89,405,947 (GRCm39) missense possibly damaging 0.77
R2018:Or4a72 UTSW 2 89,405,737 (GRCm39) missense probably damaging 0.97
R2019:Or4a72 UTSW 2 89,405,737 (GRCm39) missense probably damaging 0.97
R2020:Or4a72 UTSW 2 89,405,305 (GRCm39) missense possibly damaging 0.88
R2030:Or4a72 UTSW 2 89,405,558 (GRCm39) missense probably benign 0.00
R2133:Or4a72 UTSW 2 89,405,600 (GRCm39) nonsense probably null
R3850:Or4a72 UTSW 2 89,405,378 (GRCm39) missense probably damaging 0.99
R4066:Or4a72 UTSW 2 89,405,523 (GRCm39) missense probably damaging 1.00
R4754:Or4a72 UTSW 2 89,405,391 (GRCm39) missense probably benign
R4923:Or4a72 UTSW 2 89,406,023 (GRCm39) missense probably damaging 0.98
R5303:Or4a72 UTSW 2 89,405,345 (GRCm39) missense possibly damaging 0.88
R5574:Or4a72 UTSW 2 89,405,321 (GRCm39) missense possibly damaging 0.94
R6083:Or4a72 UTSW 2 89,406,016 (GRCm39) missense probably benign 0.42
R6188:Or4a72 UTSW 2 89,405,538 (GRCm39) nonsense probably null
R6724:Or4a72 UTSW 2 89,405,309 (GRCm39) missense probably benign 0.26
R6964:Or4a72 UTSW 2 89,405,333 (GRCm39) missense probably benign
R7066:Or4a72 UTSW 2 89,406,047 (GRCm39) missense probably damaging 0.98
R7401:Or4a72 UTSW 2 89,405,449 (GRCm39) missense probably benign 0.27
R8232:Or4a72 UTSW 2 89,405,938 (GRCm39) missense noncoding transcript
R8558:Or4a72 UTSW 2 89,405,329 (GRCm39) missense probably damaging 1.00
R8708:Or4a72 UTSW 2 89,405,623 (GRCm39) missense probably damaging 1.00
R9482:Or4a72 UTSW 2 89,405,953 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGCAATGGACAAGACCACAC -3'
(R):5'- CACTGTTATTGCTAATGGTGGAGC -3'

Sequencing Primer
(F):5'- GACCACACACCCTTTGTTTATAAC -3'
(R):5'- GAGCCATGTGTATTGTGATCTTC -3'
Posted On 2014-08-25