Incidental Mutation 'R2021:Matn4'
ID223944
Institutional Source Beutler Lab
Gene Symbol Matn4
Ensembl Gene ENSMUSG00000016995
Gene Namematrilin 4
Synonymsmatrilin-4
MMRRC Submission 040030-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2021 (G1)
Quality Score214
Status Not validated
Chromosome2
Chromosomal Location164389393-164405160 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 164400653 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 175 (V175A)
Ref Sequence ENSEMBL: ENSMUSP00000104983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017151] [ENSMUST00000103103] [ENSMUST00000103104] [ENSMUST00000109358] [ENSMUST00000109359]
Predicted Effect probably benign
Transcript: ENSMUST00000017151
SMART Domains Protein: ENSMUSP00000017151
Gene: ENSMUSG00000017007

DomainStartEndE-ValueType
LAG1_DNAbind 66 204 4.58e-78 SMART
BTD 205 357 1.23e-83 SMART
SCOP:d1a02n1 383 475 3e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000103103
AA Change: V175A

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099392
Gene: ENSMUSG00000016995
AA Change: V175A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 34 209 8.6e-54 SMART
EGF 220 257 1.04e-3 SMART
EGF 261 298 3.43e-4 SMART
EGF 302 339 1.85e0 SMART
EGF 343 380 1.24e-1 SMART
VWA 386 564 6.72e-56 SMART
Matrilin_ccoil 574 621 2.39e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000103104
AA Change: V175A

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099393
Gene: ENSMUSG00000016995
AA Change: V175A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 34 209 8.6e-54 SMART
EGF 220 257 1.04e-3 SMART
EGF 261 298 3.43e-4 SMART
EGF 302 339 1.85e0 SMART
EGF 343 380 1.24e-1 SMART
VWA 386 564 6.72e-56 SMART
Matrilin_ccoil 574 621 2.39e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000109356
Predicted Effect probably damaging
Transcript: ENSMUST00000109358
AA Change: V175A

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104982
Gene: ENSMUSG00000016995
AA Change: V175A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 34 209 8.6e-54 SMART
EGF 220 257 1.85e0 SMART
EGF 261 298 1.24e-1 SMART
VWA 304 482 6.72e-56 SMART
Matrilin_ccoil 492 539 2.39e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109359
AA Change: V175A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104983
Gene: ENSMUSG00000016995
AA Change: V175A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 34 209 8.6e-54 SMART
EGF 220 257 3.43e-4 SMART
EGF 261 298 1.85e0 SMART
EGF 302 339 1.24e-1 SMART
VWA 345 523 6.72e-56 SMART
Matrilin_ccoil 533 580 2.39e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137427
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154940
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of von Willebrand factor A domain-containing protein family. The proteins of this family are thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. This family member is thought to be play a role in reorganizing and regenerating the corneal matrix in granular and lattice type I dystrophies. It may also be involved in wound healing in the dentin-pulp complex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T C 6: 48,931,451 S462P probably damaging Het
Ablim1 A T 19: 57,047,018 S316T probably damaging Het
Alox8 C T 11: 69,186,288 V460I probably damaging Het
Arvcf G A 16: 18,399,732 A491T probably damaging Het
Asnsd1 A G 1: 53,347,227 S414P possibly damaging Het
Btbd7 A G 12: 102,790,709 L706P probably damaging Het
Camk2d T A 3: 126,780,456 W171R probably damaging Het
Casc3 T A 11: 98,821,506 S124T probably benign Het
Casp8ap2 T C 4: 32,644,560 V1211A probably benign Het
Ccdc182 T C 11: 88,294,136 V14A possibly damaging Het
Ccdc80 A T 16: 45,122,912 Q795L probably damaging Het
Ccdc88a T G 11: 29,503,480 S1614R probably damaging Het
Clcn6 A G 4: 148,010,652 probably null Het
Cubn A G 2: 13,308,549 V3070A probably benign Het
Dst G A 1: 34,166,291 V1025I possibly damaging Het
Dusp27 A T 1: 166,100,823 W407R probably benign Het
Elk3 T A 10: 93,265,677 I71F probably damaging Het
Flt3 A T 5: 147,369,490 I276N probably damaging Het
Frem1 G T 4: 82,913,558 T1988K probably benign Het
Gm597 A T 1: 28,778,153 V266D probably damaging Het
Golph3l T A 3: 95,617,357 D306E probably benign Het
Grk2 T A 19: 4,290,670 I254F probably damaging Het
Hgf C T 5: 16,576,921 T214I probably benign Het
Hoxc5 C A 15: 103,014,382 probably null Het
Hsd11b1 T C 1: 193,240,378 T124A probably benign Het
Ipp A G 4: 116,515,368 Y198C probably benign Het
Ism1 T A 2: 139,740,127 probably null Het
Klhl42 A G 6: 147,091,896 Y122C possibly damaging Het
Klk1b21 A T 7: 44,105,994 K206* probably null Het
Lcn11 A G 2: 25,778,085 K85R probably benign Het
Macf1 G T 4: 123,472,730 A2746E probably damaging Het
Myh2 A T 11: 67,191,719 N1372Y probably damaging Het
Ncl A G 1: 86,356,955 probably null Het
Nudt2 A G 4: 41,480,255 D46G probably damaging Het
Obscn C T 11: 59,067,174 D3567N probably benign Het
Olfr1245 A T 2: 89,574,961 M255K possibly damaging Het
Olfr346 G C 2: 36,688,475 V158L probably benign Het
Olfr373 G T 8: 72,100,086 V109F possibly damaging Het
Pamr1 T A 2: 102,634,535 M343K probably benign Het
Pcdh15 T G 10: 74,631,193 S1684A possibly damaging Het
Ppm1h T A 10: 122,878,528 L324* probably null Het
Ppp3r2 T C 4: 49,681,723 I76V probably benign Het
Prkdc G A 16: 15,677,009 V748I probably benign Het
Prss47 A G 13: 65,051,777 V96A probably benign Het
Rsbn1 C T 3: 103,914,473 T8I probably benign Het
Rsf1 GGCG GGCGACGGCGGCG 7: 97,579,906 probably benign Het
Serpinb3d A G 1: 107,078,452 V302A probably benign Het
Sfrp4 A T 13: 19,632,326 I177F probably benign Het
Sh3bp2 A G 5: 34,544,225 probably benign Het
Slc7a12 A G 3: 14,497,333 T257A probably damaging Het
Specc1l T C 10: 75,267,591 probably null Het
Stard9 A G 2: 120,704,235 T3658A probably benign Het
Tctex1d4 A G 4: 117,128,307 E109G possibly damaging Het
Tmem2 G A 19: 21,844,750 A1170T possibly damaging Het
Tmem30c T C 16: 57,281,362 T68A probably damaging Het
Tnr A G 1: 159,852,022 I189V probably benign Het
Trrap A G 5: 144,853,488 N3586S possibly damaging Het
Usp14 T C 18: 10,024,632 T22A probably damaging Het
Vmn1r68 A G 7: 10,527,991 L60P probably damaging Het
Vmn2r108 G A 17: 20,470,990 H424Y probably benign Het
Wdr81 C A 11: 75,445,962 E1534* probably null Het
Zc3h13 A G 14: 75,330,195 E976G probably damaging Het
Zfp128 T C 7: 12,890,029 L108P possibly damaging Het
Zfp644 T C 5: 106,635,682 I1000V possibly damaging Het
Other mutations in Matn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01745:Matn4 APN 2 164400743 missense probably damaging 0.97
IGL02188:Matn4 APN 2 164400866 missense probably benign 0.00
IGL02195:Matn4 APN 2 164401052 missense probably damaging 1.00
IGL02696:Matn4 APN 2 164396838 missense probably benign 0.09
IGL02927:Matn4 APN 2 164389837 missense probably damaging 1.00
R2022:Matn4 UTSW 2 164400653 missense probably damaging 1.00
R2272:Matn4 UTSW 2 164397242 missense possibly damaging 0.92
R2448:Matn4 UTSW 2 164401850 missense probably benign 0.04
R4824:Matn4 UTSW 2 164393231 missense probably benign 0.01
R4839:Matn4 UTSW 2 164400976 missense probably benign 0.00
R5884:Matn4 UTSW 2 164404608 utr 5 prime probably benign
R5914:Matn4 UTSW 2 164393224 missense probably damaging 1.00
R6209:Matn4 UTSW 2 164400815 missense probably damaging 1.00
R6995:Matn4 UTSW 2 164389664 nonsense probably null
R7679:Matn4 UTSW 2 164389658 makesense probably null
R8035:Matn4 UTSW 2 164397040 missense probably damaging 0.99
X0063:Matn4 UTSW 2 164397277 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TAGAATGAGCATCTGCATTGCCTG -3'
(R):5'- AGGACATGGAACGAGCCATC -3'

Sequencing Primer
(F):5'- CATCTGCATTGCCTGAGCTGG -3'
(R):5'- ATGACCGGGCTGGCGATC -3'
Posted On2014-08-25