Incidental Mutation 'R2021:Casp8ap2'
ID 223953
Institutional Source Beutler Lab
Gene Symbol Casp8ap2
Ensembl Gene ENSMUSG00000028282
Gene Name caspase 8 associated protein 2
Synonyms FLASH, D4Ertd659e
MMRRC Submission 040030-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2021 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 32615462-32653271 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 32644560 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1211 (V1211A)
Ref Sequence ENSEMBL: ENSMUSP00000136016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029950] [ENSMUST00000108178] [ENSMUST00000178925]
AlphaFold Q9WUF3
Predicted Effect probably benign
Transcript: ENSMUST00000029950
AA Change: V1211A

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000029950
Gene: ENSMUSG00000028282
AA Change: V1211A

DomainStartEndE-ValueType
coiled coil region 68 142 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 458 477 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1250 1268 N/A INTRINSIC
low complexity region 1360 1377 N/A INTRINSIC
low complexity region 1458 1470 N/A INTRINSIC
low complexity region 1477 1498 N/A INTRINSIC
low complexity region 1882 1895 N/A INTRINSIC
PDB:2LR8|A 1896 1962 1e-31 PDB
Blast:SANT 1905 1955 2e-21 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000108178
SMART Domains Protein: ENSMUSP00000103813
Gene: ENSMUSG00000028282

DomainStartEndE-ValueType
PDB:2LR8|A 126 190 4e-26 PDB
Blast:SANT 139 183 4e-19 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000178925
AA Change: V1211A

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000136016
Gene: ENSMUSG00000028282
AA Change: V1211A

DomainStartEndE-ValueType
coiled coil region 68 142 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 458 477 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1250 1268 N/A INTRINSIC
low complexity region 1360 1377 N/A INTRINSIC
low complexity region 1458 1470 N/A INTRINSIC
low complexity region 1477 1498 N/A INTRINSIC
low complexity region 1882 1895 N/A INTRINSIC
PDB:2LR8|A 1896 1962 1e-31 PDB
Blast:SANT 1905 1955 2e-21 BLAST
Meta Mutation Damage Score 0.0700 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein is highly similar to FLASH, a mouse apoptotic protein identified by its interaction with the death-effector domain (DED) of caspase 8. Studies of FLASH protein suggested that this protein may be a component of the death-inducing signaling complex that includes Fas receptor, Fas-binding adapter FADD, and caspase 8, and plays a regulatory role in Fas-mediated apoptosis. Alternative splicing results in multiple transcript variants encoding the same protein.[provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for disruption of this gene die before implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 A T 19: 57,035,450 (GRCm39) S316T probably damaging Het
Alox8 C T 11: 69,077,114 (GRCm39) V460I probably damaging Het
Aoc1l2 T C 6: 48,908,385 (GRCm39) S462P probably damaging Het
Arvcf G A 16: 18,218,482 (GRCm39) A491T probably damaging Het
Asnsd1 A G 1: 53,386,386 (GRCm39) S414P possibly damaging Het
Btbd7 A G 12: 102,756,968 (GRCm39) L706P probably damaging Het
Camk2d T A 3: 126,574,105 (GRCm39) W171R probably damaging Het
Casc3 T A 11: 98,712,332 (GRCm39) S124T probably benign Het
Ccdc182 T C 11: 88,184,962 (GRCm39) V14A possibly damaging Het
Ccdc80 A T 16: 44,943,275 (GRCm39) Q795L probably damaging Het
Ccdc88a T G 11: 29,453,480 (GRCm39) S1614R probably damaging Het
Cemip2 G A 19: 21,822,114 (GRCm39) A1170T possibly damaging Het
Clcn6 A G 4: 148,095,109 (GRCm39) probably null Het
Cubn A G 2: 13,313,360 (GRCm39) V3070A probably benign Het
Dst G A 1: 34,205,372 (GRCm39) V1025I possibly damaging Het
Dynlt4 A G 4: 116,985,504 (GRCm39) E109G possibly damaging Het
Elk3 T A 10: 93,101,539 (GRCm39) I71F probably damaging Het
Flt3 A T 5: 147,306,300 (GRCm39) I276N probably damaging Het
Frem1 G T 4: 82,831,795 (GRCm39) T1988K probably benign Het
Golph3l T A 3: 95,524,668 (GRCm39) D306E probably benign Het
Grk2 T A 19: 4,340,698 (GRCm39) I254F probably damaging Het
Hgf C T 5: 16,781,919 (GRCm39) T214I probably benign Het
Hoxc5 C A 15: 102,922,814 (GRCm39) probably null Het
Hsd11b1 T C 1: 192,922,686 (GRCm39) T124A probably benign Het
Ipp A G 4: 116,372,565 (GRCm39) Y198C probably benign Het
Ism1 T A 2: 139,582,047 (GRCm39) probably null Het
Klhl42 A G 6: 146,993,394 (GRCm39) Y122C possibly damaging Het
Klk1b21 A T 7: 43,755,418 (GRCm39) K206* probably null Het
Lcn11 A G 2: 25,668,097 (GRCm39) K85R probably benign Het
Macf1 G T 4: 123,366,523 (GRCm39) A2746E probably damaging Het
Matn4 A G 2: 164,242,573 (GRCm39) V175A probably damaging Het
Myh2 A T 11: 67,082,545 (GRCm39) N1372Y probably damaging Het
Ncl A G 1: 86,284,677 (GRCm39) probably null Het
Nudt2 A G 4: 41,480,255 (GRCm39) D46G probably damaging Het
Obscn C T 11: 58,958,000 (GRCm39) D3567N probably benign Het
Or1j17 G C 2: 36,578,487 (GRCm39) V158L probably benign Het
Or2z9 G T 8: 72,853,930 (GRCm39) V109F possibly damaging Het
Or4a72 A T 2: 89,405,305 (GRCm39) M255K possibly damaging Het
Pamr1 T A 2: 102,464,880 (GRCm39) M343K probably benign Het
Pcdh15 T G 10: 74,467,025 (GRCm39) S1684A possibly damaging Het
Ppm1h T A 10: 122,714,433 (GRCm39) L324* probably null Het
Ppp3r2 T C 4: 49,681,723 (GRCm39) I76V probably benign Het
Prkdc G A 16: 15,494,873 (GRCm39) V748I probably benign Het
Prss47 A G 13: 65,199,591 (GRCm39) V96A probably benign Het
Rsbn1 C T 3: 103,821,789 (GRCm39) T8I probably benign Het
Rsf1 GGCG GGCGACGGCGGCG 7: 97,229,113 (GRCm39) probably benign Het
Serpinb3d A G 1: 107,006,182 (GRCm39) V302A probably benign Het
Sfrp4 A T 13: 19,816,496 (GRCm39) I177F probably benign Het
Sh3bp2 A G 5: 34,701,569 (GRCm39) probably benign Het
Slc7a12 A G 3: 14,562,393 (GRCm39) T257A probably damaging Het
Spata31e5 A T 1: 28,817,234 (GRCm39) V266D probably damaging Het
Specc1l T C 10: 75,103,425 (GRCm39) probably null Het
Stard9 A G 2: 120,534,716 (GRCm39) T3658A probably benign Het
Styxl2 A T 1: 165,928,392 (GRCm39) W407R probably benign Het
Tmem30c T C 16: 57,101,725 (GRCm39) T68A probably damaging Het
Tnr A G 1: 159,679,592 (GRCm39) I189V probably benign Het
Trrap A G 5: 144,790,298 (GRCm39) N3586S possibly damaging Het
Usp14 T C 18: 10,024,632 (GRCm39) T22A probably damaging Het
Vmn1r68 A G 7: 10,261,918 (GRCm39) L60P probably damaging Het
Vmn2r108 G A 17: 20,691,252 (GRCm39) H424Y probably benign Het
Wdr81 C A 11: 75,336,788 (GRCm39) E1534* probably null Het
Zc3h13 A G 14: 75,567,635 (GRCm39) E976G probably damaging Het
Zfp128 T C 7: 12,623,956 (GRCm39) L108P possibly damaging Het
Zfp644 T C 5: 106,783,548 (GRCm39) I1000V possibly damaging Het
Other mutations in Casp8ap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00686:Casp8ap2 APN 4 32,641,433 (GRCm39) missense probably damaging 1.00
IGL00714:Casp8ap2 APN 4 32,649,192 (GRCm39) missense probably damaging 1.00
IGL00754:Casp8ap2 APN 4 32,641,036 (GRCm39) missense probably benign 0.00
IGL00954:Casp8ap2 APN 4 32,645,403 (GRCm39) missense probably damaging 1.00
IGL00970:Casp8ap2 APN 4 32,646,182 (GRCm39) missense probably benign
IGL01534:Casp8ap2 APN 4 32,648,134 (GRCm39) splice site probably benign
IGL01596:Casp8ap2 APN 4 32,646,365 (GRCm39) missense probably damaging 1.00
IGL01686:Casp8ap2 APN 4 32,641,294 (GRCm39) missense possibly damaging 0.94
IGL02002:Casp8ap2 APN 4 32,639,391 (GRCm39) missense probably damaging 1.00
IGL02273:Casp8ap2 APN 4 32,643,974 (GRCm39) missense probably damaging 1.00
IGL02510:Casp8ap2 APN 4 32,639,704 (GRCm39) missense probably benign 0.05
IGL02600:Casp8ap2 APN 4 32,630,246 (GRCm39) missense probably null 1.00
IGL02929:Casp8ap2 APN 4 32,624,105 (GRCm39) utr 5 prime probably benign
F5770:Casp8ap2 UTSW 4 32,639,944 (GRCm39) missense probably benign 0.00
IGL02988:Casp8ap2 UTSW 4 32,644,590 (GRCm39) missense probably benign 0.14
R0023:Casp8ap2 UTSW 4 32,640,185 (GRCm39) missense probably damaging 0.99
R0027:Casp8ap2 UTSW 4 32,643,810 (GRCm39) missense probably benign 0.01
R0090:Casp8ap2 UTSW 4 32,640,327 (GRCm39) missense probably damaging 1.00
R0117:Casp8ap2 UTSW 4 32,640,817 (GRCm39) missense probably benign 0.00
R0144:Casp8ap2 UTSW 4 32,643,797 (GRCm39) missense possibly damaging 0.50
R0268:Casp8ap2 UTSW 4 32,644,079 (GRCm39) missense probably damaging 0.99
R0344:Casp8ap2 UTSW 4 32,644,079 (GRCm39) missense probably damaging 0.99
R0555:Casp8ap2 UTSW 4 32,640,381 (GRCm39) missense probably damaging 1.00
R1051:Casp8ap2 UTSW 4 32,640,790 (GRCm39) missense probably benign 0.28
R1165:Casp8ap2 UTSW 4 32,640,563 (GRCm39) missense probably benign 0.01
R1243:Casp8ap2 UTSW 4 32,645,687 (GRCm39) missense probably benign 0.03
R1311:Casp8ap2 UTSW 4 32,648,111 (GRCm39) missense probably damaging 0.98
R1337:Casp8ap2 UTSW 4 32,645,721 (GRCm39) missense possibly damaging 0.64
R1471:Casp8ap2 UTSW 4 32,639,386 (GRCm39) nonsense probably null
R1497:Casp8ap2 UTSW 4 32,639,938 (GRCm39) missense probably benign 0.00
R1521:Casp8ap2 UTSW 4 32,631,867 (GRCm39) missense probably damaging 1.00
R1588:Casp8ap2 UTSW 4 32,640,541 (GRCm39) missense probably benign 0.00
R1625:Casp8ap2 UTSW 4 32,648,068 (GRCm39) missense probably benign 0.04
R1731:Casp8ap2 UTSW 4 32,641,442 (GRCm39) missense possibly damaging 0.94
R1899:Casp8ap2 UTSW 4 32,643,647 (GRCm39) missense probably damaging 0.98
R2000:Casp8ap2 UTSW 4 32,634,874 (GRCm39) missense probably damaging 1.00
R2022:Casp8ap2 UTSW 4 32,644,560 (GRCm39) missense probably benign 0.05
R2023:Casp8ap2 UTSW 4 32,644,560 (GRCm39) missense probably benign 0.05
R2088:Casp8ap2 UTSW 4 32,631,126 (GRCm39) missense probably damaging 1.00
R2104:Casp8ap2 UTSW 4 32,644,727 (GRCm39) missense probably benign 0.00
R2128:Casp8ap2 UTSW 4 32,640,142 (GRCm39) missense probably benign 0.06
R2129:Casp8ap2 UTSW 4 32,640,142 (GRCm39) missense probably benign 0.06
R2305:Casp8ap2 UTSW 4 32,646,411 (GRCm39) missense probably damaging 1.00
R2316:Casp8ap2 UTSW 4 32,643,781 (GRCm39) missense probably benign 0.31
R2919:Casp8ap2 UTSW 4 32,645,343 (GRCm39) missense probably damaging 1.00
R4091:Casp8ap2 UTSW 4 32,643,611 (GRCm39) missense probably damaging 1.00
R4357:Casp8ap2 UTSW 4 32,646,150 (GRCm39) missense probably benign 0.00
R4807:Casp8ap2 UTSW 4 32,644,505 (GRCm39) missense possibly damaging 0.89
R4828:Casp8ap2 UTSW 4 32,639,807 (GRCm39) missense probably benign
R4908:Casp8ap2 UTSW 4 32,639,905 (GRCm39) missense possibly damaging 0.90
R4945:Casp8ap2 UTSW 4 32,631,163 (GRCm39) missense possibly damaging 0.57
R4962:Casp8ap2 UTSW 4 32,640,554 (GRCm39) missense probably damaging 0.99
R6014:Casp8ap2 UTSW 4 32,641,400 (GRCm39) missense probably damaging 0.97
R6092:Casp8ap2 UTSW 4 32,639,380 (GRCm39) missense probably damaging 1.00
R6257:Casp8ap2 UTSW 4 32,641,364 (GRCm39) missense possibly damaging 0.94
R6289:Casp8ap2 UTSW 4 32,639,590 (GRCm39) missense probably damaging 1.00
R6482:Casp8ap2 UTSW 4 32,634,813 (GRCm39) missense probably damaging 1.00
R6496:Casp8ap2 UTSW 4 32,641,553 (GRCm39) missense probably benign 0.05
R6515:Casp8ap2 UTSW 4 32,646,423 (GRCm39) missense possibly damaging 0.64
R7015:Casp8ap2 UTSW 4 32,644,278 (GRCm39) missense probably damaging 1.00
R7033:Casp8ap2 UTSW 4 32,639,392 (GRCm39) missense probably damaging 1.00
R7072:Casp8ap2 UTSW 4 32,644,766 (GRCm39) missense probably damaging 1.00
R7448:Casp8ap2 UTSW 4 32,643,974 (GRCm39) missense possibly damaging 0.84
R7944:Casp8ap2 UTSW 4 32,645,909 (GRCm39) missense probably benign 0.12
R7945:Casp8ap2 UTSW 4 32,645,909 (GRCm39) missense probably benign 0.12
R8170:Casp8ap2 UTSW 4 32,615,490 (GRCm39) splice site probably benign
R8179:Casp8ap2 UTSW 4 32,643,939 (GRCm39) nonsense probably null
R8207:Casp8ap2 UTSW 4 32,646,446 (GRCm39) missense possibly damaging 0.63
R8263:Casp8ap2 UTSW 4 32,644,072 (GRCm39) missense probably damaging 1.00
R8298:Casp8ap2 UTSW 4 32,640,429 (GRCm39) missense probably benign 0.30
R9441:Casp8ap2 UTSW 4 32,645,873 (GRCm39) missense probably benign 0.00
R9455:Casp8ap2 UTSW 4 32,643,924 (GRCm39) missense possibly damaging 0.85
R9729:Casp8ap2 UTSW 4 32,643,807 (GRCm39) missense possibly damaging 0.71
V7580:Casp8ap2 UTSW 4 32,639,944 (GRCm39) missense probably benign 0.00
X0018:Casp8ap2 UTSW 4 32,643,738 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GGCATAGTTGACCGTTTATTTGAACAG -3'
(R):5'- TCGGACTTAGCACTTGCATG -3'

Sequencing Primer
(F):5'- GACCGTTTATTTGAACAGCAACAAAC -3'
(R):5'- ATGCTGTGCCGCCTGTG -3'
Posted On 2014-08-25