Incidental Mutation 'R2021:Ppp3r2'
ID 223958
Institutional Source Beutler Lab
Gene Symbol Ppp3r2
Ensembl Gene ENSMUSG00000028310
Gene Name protein phosphatase 3, regulatory subunit B, alpha isoform (calcineurin B, type II)
Synonyms CnB2, CaNB2, PP2B beta 2
MMRRC Submission 040030-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.080) question?
Stock # R2021 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 49678747-49681983 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 49681723 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 76 (I76V)
Ref Sequence ENSEMBL: ENSMUSP00000029991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029991] [ENSMUST00000076674] [ENSMUST00000093859]
AlphaFold Q63811
Predicted Effect probably benign
Transcript: ENSMUST00000029991
AA Change: I76V

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000029991
Gene: ENSMUSG00000028310
AA Change: I76V

DomainStartEndE-ValueType
EFh 22 50 1.72e0 SMART
EFh 54 82 2.37e-3 SMART
EFh 91 119 4.19e-4 SMART
EFh 132 160 1.73e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000076674
SMART Domains Protein: ENSMUSP00000075970
Gene: ENSMUSG00000039579

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 161 181 N/A INTRINSIC
Lig_chan-Glu_bd 557 622 9.62e-22 SMART
PBPe 565 910 1.43e-73 SMART
transmembrane domain 934 956 N/A INTRINSIC
coiled coil region 1063 1105 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093859
SMART Domains Protein: ENSMUSP00000091381
Gene: ENSMUSG00000039579

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 161 181 N/A INTRINSIC
Lig_chan-Glu_bd 557 622 9.62e-22 SMART
PBPe 565 910 1.43e-73 SMART
transmembrane domain 934 956 N/A INTRINSIC
coiled coil region 1083 1125 N/A INTRINSIC
Meta Mutation Damage Score 0.0626 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility due to reduced hyperactivated sperm motility and midpiece rigidity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 A T 19: 57,035,450 (GRCm39) S316T probably damaging Het
Alox8 C T 11: 69,077,114 (GRCm39) V460I probably damaging Het
Aoc1l2 T C 6: 48,908,385 (GRCm39) S462P probably damaging Het
Arvcf G A 16: 18,218,482 (GRCm39) A491T probably damaging Het
Asnsd1 A G 1: 53,386,386 (GRCm39) S414P possibly damaging Het
Btbd7 A G 12: 102,756,968 (GRCm39) L706P probably damaging Het
Camk2d T A 3: 126,574,105 (GRCm39) W171R probably damaging Het
Casc3 T A 11: 98,712,332 (GRCm39) S124T probably benign Het
Casp8ap2 T C 4: 32,644,560 (GRCm39) V1211A probably benign Het
Ccdc182 T C 11: 88,184,962 (GRCm39) V14A possibly damaging Het
Ccdc80 A T 16: 44,943,275 (GRCm39) Q795L probably damaging Het
Ccdc88a T G 11: 29,453,480 (GRCm39) S1614R probably damaging Het
Cemip2 G A 19: 21,822,114 (GRCm39) A1170T possibly damaging Het
Clcn6 A G 4: 148,095,109 (GRCm39) probably null Het
Cubn A G 2: 13,313,360 (GRCm39) V3070A probably benign Het
Dst G A 1: 34,205,372 (GRCm39) V1025I possibly damaging Het
Dynlt4 A G 4: 116,985,504 (GRCm39) E109G possibly damaging Het
Elk3 T A 10: 93,101,539 (GRCm39) I71F probably damaging Het
Flt3 A T 5: 147,306,300 (GRCm39) I276N probably damaging Het
Frem1 G T 4: 82,831,795 (GRCm39) T1988K probably benign Het
Golph3l T A 3: 95,524,668 (GRCm39) D306E probably benign Het
Grk2 T A 19: 4,340,698 (GRCm39) I254F probably damaging Het
Hgf C T 5: 16,781,919 (GRCm39) T214I probably benign Het
Hoxc5 C A 15: 102,922,814 (GRCm39) probably null Het
Hsd11b1 T C 1: 192,922,686 (GRCm39) T124A probably benign Het
Ipp A G 4: 116,372,565 (GRCm39) Y198C probably benign Het
Ism1 T A 2: 139,582,047 (GRCm39) probably null Het
Klhl42 A G 6: 146,993,394 (GRCm39) Y122C possibly damaging Het
Klk1b21 A T 7: 43,755,418 (GRCm39) K206* probably null Het
Lcn11 A G 2: 25,668,097 (GRCm39) K85R probably benign Het
Macf1 G T 4: 123,366,523 (GRCm39) A2746E probably damaging Het
Matn4 A G 2: 164,242,573 (GRCm39) V175A probably damaging Het
Myh2 A T 11: 67,082,545 (GRCm39) N1372Y probably damaging Het
Ncl A G 1: 86,284,677 (GRCm39) probably null Het
Nudt2 A G 4: 41,480,255 (GRCm39) D46G probably damaging Het
Obscn C T 11: 58,958,000 (GRCm39) D3567N probably benign Het
Or1j17 G C 2: 36,578,487 (GRCm39) V158L probably benign Het
Or2z9 G T 8: 72,853,930 (GRCm39) V109F possibly damaging Het
Or4a72 A T 2: 89,405,305 (GRCm39) M255K possibly damaging Het
Pamr1 T A 2: 102,464,880 (GRCm39) M343K probably benign Het
Pcdh15 T G 10: 74,467,025 (GRCm39) S1684A possibly damaging Het
Ppm1h T A 10: 122,714,433 (GRCm39) L324* probably null Het
Prkdc G A 16: 15,494,873 (GRCm39) V748I probably benign Het
Prss47 A G 13: 65,199,591 (GRCm39) V96A probably benign Het
Rsbn1 C T 3: 103,821,789 (GRCm39) T8I probably benign Het
Rsf1 GGCG GGCGACGGCGGCG 7: 97,229,113 (GRCm39) probably benign Het
Serpinb3d A G 1: 107,006,182 (GRCm39) V302A probably benign Het
Sfrp4 A T 13: 19,816,496 (GRCm39) I177F probably benign Het
Sh3bp2 A G 5: 34,701,569 (GRCm39) probably benign Het
Slc7a12 A G 3: 14,562,393 (GRCm39) T257A probably damaging Het
Spata31e5 A T 1: 28,817,234 (GRCm39) V266D probably damaging Het
Specc1l T C 10: 75,103,425 (GRCm39) probably null Het
Stard9 A G 2: 120,534,716 (GRCm39) T3658A probably benign Het
Styxl2 A T 1: 165,928,392 (GRCm39) W407R probably benign Het
Tmem30c T C 16: 57,101,725 (GRCm39) T68A probably damaging Het
Tnr A G 1: 159,679,592 (GRCm39) I189V probably benign Het
Trrap A G 5: 144,790,298 (GRCm39) N3586S possibly damaging Het
Usp14 T C 18: 10,024,632 (GRCm39) T22A probably damaging Het
Vmn1r68 A G 7: 10,261,918 (GRCm39) L60P probably damaging Het
Vmn2r108 G A 17: 20,691,252 (GRCm39) H424Y probably benign Het
Wdr81 C A 11: 75,336,788 (GRCm39) E1534* probably null Het
Zc3h13 A G 14: 75,567,635 (GRCm39) E976G probably damaging Het
Zfp128 T C 7: 12,623,956 (GRCm39) L108P possibly damaging Het
Zfp644 T C 5: 106,783,548 (GRCm39) I1000V possibly damaging Het
Other mutations in Ppp3r2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:Ppp3r2 APN 4 49,681,773 (GRCm39) missense possibly damaging 0.84
IGL03371:Ppp3r2 APN 4 49,681,630 (GRCm39) missense probably damaging 1.00
R0365:Ppp3r2 UTSW 4 49,681,902 (GRCm39) missense possibly damaging 0.77
R0928:Ppp3r2 UTSW 4 49,681,439 (GRCm39) critical splice donor site probably null
R1957:Ppp3r2 UTSW 4 49,681,726 (GRCm39) missense probably damaging 1.00
R2022:Ppp3r2 UTSW 4 49,681,723 (GRCm39) missense probably benign 0.02
R2023:Ppp3r2 UTSW 4 49,681,723 (GRCm39) missense probably benign 0.02
R6102:Ppp3r2 UTSW 4 49,682,022 (GRCm39) intron probably benign
R6385:Ppp3r2 UTSW 4 49,681,767 (GRCm39) missense possibly damaging 0.87
R8046:Ppp3r2 UTSW 4 49,681,913 (GRCm39) nonsense probably null
R8315:Ppp3r2 UTSW 4 49,681,705 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGATGCTCTTGTCCACCAGC -3'
(R):5'- AGGCCAGCTACCAAACTGAG -3'

Sequencing Primer
(F):5'- TGTCCACCAGCTGCTGCAG -3'
(R):5'- GCTACCAAACTGAGCTGTGC -3'
Posted On 2014-08-25