Incidental Mutation 'R2021:Ipp'
ID223961
Institutional Source Beutler Lab
Gene Symbol Ipp
Ensembl Gene ENSMUSG00000028696
Gene NameIAP promoted placental gene
SynonymsD4Jhu8, Mipp
MMRRC Submission 040030-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2021 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location116507549-116538243 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116515368 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 198 (Y198C)
Ref Sequence ENSEMBL: ENSMUSP00000102088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030461] [ENSMUST00000106479]
Predicted Effect probably benign
Transcript: ENSMUST00000030461
AA Change: Y198C

PolyPhen 2 Score 0.263 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000030461
Gene: ENSMUSG00000028696
AA Change: Y198C

DomainStartEndE-ValueType
BTB 37 134 5.37e-30 SMART
BACK 139 241 6.59e-29 SMART
Kelch 289 343 3.8e-9 SMART
Kelch 344 390 1.61e-12 SMART
Kelch 391 437 2.9e-14 SMART
Kelch 438 485 1.94e-15 SMART
Kelch 486 533 2.79e-16 SMART
Kelch 534 584 1.67e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106479
AA Change: Y198C

PolyPhen 2 Score 0.263 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000102088
Gene: ENSMUSG00000028696
AA Change: Y198C

DomainStartEndE-ValueType
BTB 37 134 5.37e-30 SMART
BACK 139 241 6.59e-29 SMART
Kelch 289 343 3.8e-9 SMART
Kelch 344 390 1.61e-12 SMART
Kelch 391 437 2.9e-14 SMART
Kelch 438 485 1.94e-15 SMART
Kelch 486 533 2.79e-16 SMART
Kelch 534 584 1.67e-5 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the kelch family of proteins, which is characterized by a 50 amino acid repeat which interacts with actin. Transcript variants have been described but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T C 6: 48,931,451 S462P probably damaging Het
Ablim1 A T 19: 57,047,018 S316T probably damaging Het
Alox8 C T 11: 69,186,288 V460I probably damaging Het
Arvcf G A 16: 18,399,732 A491T probably damaging Het
Asnsd1 A G 1: 53,347,227 S414P possibly damaging Het
Btbd7 A G 12: 102,790,709 L706P probably damaging Het
Camk2d T A 3: 126,780,456 W171R probably damaging Het
Casc3 T A 11: 98,821,506 S124T probably benign Het
Casp8ap2 T C 4: 32,644,560 V1211A probably benign Het
Ccdc182 T C 11: 88,294,136 V14A possibly damaging Het
Ccdc80 A T 16: 45,122,912 Q795L probably damaging Het
Ccdc88a T G 11: 29,503,480 S1614R probably damaging Het
Clcn6 A G 4: 148,010,652 probably null Het
Cubn A G 2: 13,308,549 V3070A probably benign Het
Dst G A 1: 34,166,291 V1025I possibly damaging Het
Dusp27 A T 1: 166,100,823 W407R probably benign Het
Elk3 T A 10: 93,265,677 I71F probably damaging Het
Flt3 A T 5: 147,369,490 I276N probably damaging Het
Frem1 G T 4: 82,913,558 T1988K probably benign Het
Gm597 A T 1: 28,778,153 V266D probably damaging Het
Golph3l T A 3: 95,617,357 D306E probably benign Het
Grk2 T A 19: 4,290,670 I254F probably damaging Het
Hgf C T 5: 16,576,921 T214I probably benign Het
Hoxc5 C A 15: 103,014,382 probably null Het
Hsd11b1 T C 1: 193,240,378 T124A probably benign Het
Ism1 T A 2: 139,740,127 probably null Het
Klhl42 A G 6: 147,091,896 Y122C possibly damaging Het
Klk1b21 A T 7: 44,105,994 K206* probably null Het
Lcn11 A G 2: 25,778,085 K85R probably benign Het
Macf1 G T 4: 123,472,730 A2746E probably damaging Het
Matn4 A G 2: 164,400,653 V175A probably damaging Het
Myh2 A T 11: 67,191,719 N1372Y probably damaging Het
Ncl A G 1: 86,356,955 probably null Het
Nudt2 A G 4: 41,480,255 D46G probably damaging Het
Obscn C T 11: 59,067,174 D3567N probably benign Het
Olfr1245 A T 2: 89,574,961 M255K possibly damaging Het
Olfr346 G C 2: 36,688,475 V158L probably benign Het
Olfr373 G T 8: 72,100,086 V109F possibly damaging Het
Pamr1 T A 2: 102,634,535 M343K probably benign Het
Pcdh15 T G 10: 74,631,193 S1684A possibly damaging Het
Ppm1h T A 10: 122,878,528 L324* probably null Het
Ppp3r2 T C 4: 49,681,723 I76V probably benign Het
Prkdc G A 16: 15,677,009 V748I probably benign Het
Prss47 A G 13: 65,051,777 V96A probably benign Het
Rsbn1 C T 3: 103,914,473 T8I probably benign Het
Rsf1 GGCG GGCGACGGCGGCG 7: 97,579,906 probably benign Het
Serpinb3d A G 1: 107,078,452 V302A probably benign Het
Sfrp4 A T 13: 19,632,326 I177F probably benign Het
Sh3bp2 A G 5: 34,544,225 probably benign Het
Slc7a12 A G 3: 14,497,333 T257A probably damaging Het
Specc1l T C 10: 75,267,591 probably null Het
Stard9 A G 2: 120,704,235 T3658A probably benign Het
Tctex1d4 A G 4: 117,128,307 E109G possibly damaging Het
Tmem2 G A 19: 21,844,750 A1170T possibly damaging Het
Tmem30c T C 16: 57,281,362 T68A probably damaging Het
Tnr A G 1: 159,852,022 I189V probably benign Het
Trrap A G 5: 144,853,488 N3586S possibly damaging Het
Usp14 T C 18: 10,024,632 T22A probably damaging Het
Vmn1r68 A G 7: 10,527,991 L60P probably damaging Het
Vmn2r108 G A 17: 20,470,990 H424Y probably benign Het
Wdr81 C A 11: 75,445,962 E1534* probably null Het
Zc3h13 A G 14: 75,330,195 E976G probably damaging Het
Zfp128 T C 7: 12,890,029 L108P possibly damaging Het
Zfp644 T C 5: 106,635,682 I1000V possibly damaging Het
Other mutations in Ipp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Ipp APN 4 116532659 missense possibly damaging 0.93
IGL01399:Ipp APN 4 116515187 missense probably damaging 1.00
IGL01934:Ipp APN 4 116510655 missense probably damaging 0.99
IGL02805:Ipp APN 4 116529688 missense possibly damaging 0.92
Iguacu UTSW 4 116537938 nonsense probably null
R0582:Ipp UTSW 4 116515467 missense probably damaging 1.00
R0669:Ipp UTSW 4 116537876 missense probably damaging 1.00
R1121:Ipp UTSW 4 116520675 missense probably benign 0.00
R1394:Ipp UTSW 4 116537912 nonsense probably null
R1738:Ipp UTSW 4 116530421 missense probably benign 0.00
R3103:Ipp UTSW 4 116524249 missense possibly damaging 0.65
R4372:Ipp UTSW 4 116515363 missense possibly damaging 0.90
R4439:Ipp UTSW 4 116515077 missense probably benign 0.00
R4571:Ipp UTSW 4 116530458 missense probably damaging 1.00
R5134:Ipp UTSW 4 116515457 missense possibly damaging 0.65
R5503:Ipp UTSW 4 116537938 nonsense probably null
R5519:Ipp UTSW 4 116510767 missense possibly damaging 0.76
R5640:Ipp UTSW 4 116520689 missense possibly damaging 0.67
R5768:Ipp UTSW 4 116510770 missense probably damaging 1.00
R6867:Ipp UTSW 4 116510409 splice site probably null
R7575:Ipp UTSW 4 116532644 missense probably benign 0.20
R7851:Ipp UTSW 4 116515475 nonsense probably null
R7992:Ipp UTSW 4 116524256 missense probably damaging 1.00
R8069:Ipp UTSW 4 116510856 missense probably benign 0.11
Z1176:Ipp UTSW 4 116537885 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- CATTGGACTCTTTCAGTTCTCTG -3'
(R):5'- GCTGTTCAATGACTTCTGACC -3'

Sequencing Primer
(F):5'- TGAGCAAATTGCCTGCCATG -3'
(R):5'- TCCCAGTTCAATGAGATAGCCTG -3'
Posted On2014-08-25