Mutagenetix > Incidental Mutation

Incidental Mutation 'R2021:Zfp644'

223975

Institutional Source

Beutler Lab

Gene Symbol

Zfp644

Ensembl Gene

ENSMUSG00000049606

Gene Name

zinc finger protein 644

Synonyms

D5Ertd689e, 1110068L01Rik, Zep-2, BM-005

MMRRC Submission

040030-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.236) question?

Stock #

R2021 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

106616739-106697287 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 106635682 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 1000 (I1000V)

Ref Sequence

ENSEMBL: ENSMUSP00000108316 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045466] [ENSMUST00000112695] [ENSMUST00000112696] [ENSMUST00000112698] [ENSMUST00000122980] [ENSMUST00000124263] [ENSMUST00000127434] [ENSMUST00000135108] [ENSMUST00000137285] [ENSMUST00000155495]

AlphaFold

E9QA22

Predicted Effect

probably benign
Transcript: ENSMUST00000045466
AA Change: I969V

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000038047
Gene: ENSMUSG00000049606
AA Change: I969V

Domain	Start	End	E-Value	Type
ZnF_C2H2	411	433	1.89e-1	SMART
ZnF_C2H2	449	471	6.52e-5	SMART
ZnF_C2H2	497	519	1.99e0	SMART
ZnF_C2H2	526	549	6.4e0	SMART
ZnF_C2H2	587	610	3.72e0	SMART
low complexity region	668	676	N/A	INTRINSIC
low complexity region	771	788	N/A	INTRINSIC
ZnF_C2H2	928	950	1.07e0	SMART
ZnF_C2H2	1003	1025	1.43e-1	SMART
low complexity region	1199	1212	N/A	INTRINSIC
ZnF_C2H2	1226	1252	5.4e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000112695

SMART Domains

Protein: ENSMUSP00000108315
Gene: ENSMUSG00000049606

Domain	Start	End	E-Value	Type
low complexity region	12	25	N/A	INTRINSIC
Blast:ZnF_C2H2	39	65	2e-14	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000112696
AA Change: I1000V

PolyPhen 2 Score 0.844 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000108316
Gene: ENSMUSG00000049606
AA Change: I1000V

Domain	Start	End	E-Value	Type
ZnF_C2H2	411	433	1.89e-1	SMART
ZnF_C2H2	449	471	6.52e-5	SMART
ZnF_C2H2	497	519	1.99e0	SMART
ZnF_C2H2	526	549	6.4e0	SMART
ZnF_C2H2	587	610	3.72e0	SMART
low complexity region	668	676	N/A	INTRINSIC
low complexity region	767	783	N/A	INTRINSIC
low complexity region	802	819	N/A	INTRINSIC
ZnF_C2H2	959	981	1.07e0	SMART
ZnF_C2H2	1034	1056	1.43e-1	SMART
low complexity region	1230	1243	N/A	INTRINSIC
ZnF_C2H2	1257	1283	5.4e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000112698
AA Change: I969V

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000108318
Gene: ENSMUSG00000049606
AA Change: I969V

Domain	Start	End	E-Value	Type
ZnF_C2H2	411	433	1.89e-1	SMART
ZnF_C2H2	449	471	6.52e-5	SMART
ZnF_C2H2	497	519	1.99e0	SMART
ZnF_C2H2	526	549	6.4e0	SMART
ZnF_C2H2	587	610	3.72e0	SMART
low complexity region	668	676	N/A	INTRINSIC
low complexity region	771	788	N/A	INTRINSIC
ZnF_C2H2	928	950	1.07e0	SMART
ZnF_C2H2	1003	1025	1.43e-1	SMART
low complexity region	1199	1212	N/A	INTRINSIC
ZnF_C2H2	1226	1252	5.4e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000122980

Predicted Effect

probably benign
Transcript: ENSMUST00000124263

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125895

Predicted Effect

probably benign
Transcript: ENSMUST00000127434

SMART Domains

Protein: ENSMUSP00000122421
Gene: ENSMUSG00000049606

Domain	Start	End	E-Value	Type
ZnF_C2H2	411	433	1.89e-1	SMART
ZnF_C2H2	449	471	6.52e-5	SMART
ZnF_C2H2	497	519	1.99e0	SMART
ZnF_C2H2	526	549	6.4e0	SMART
ZnF_C2H2	587	610	3.72e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000135108

Predicted Effect

probably benign
Transcript: ENSMUST00000137285

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149128

Predicted Effect

probably benign
Transcript: ENSMUST00000155495

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcription factor that may play a role in eye development. Defects in this gene have been associated with high myopia. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit normal blood lymphocyte populations. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600015I10Rik	T	C	6: 48,931,451	S462P	probably damaging	Het
Ablim1	A	T	19: 57,047,018	S316T	probably damaging	Het
Alox8	C	T	11: 69,186,288	V460I	probably damaging	Het
Arvcf	G	A	16: 18,399,732	A491T	probably damaging	Het
Asnsd1	A	G	1: 53,347,227	S414P	possibly damaging	Het
Btbd7	A	G	12: 102,790,709	L706P	probably damaging	Het
Camk2d	T	A	3: 126,780,456	W171R	probably damaging	Het
Casc3	T	A	11: 98,821,506	S124T	probably benign	Het
Casp8ap2	T	C	4: 32,644,560	V1211A	probably benign	Het
Ccdc182	T	C	11: 88,294,136	V14A	possibly damaging	Het
Ccdc80	A	T	16: 45,122,912	Q795L	probably damaging	Het
Ccdc88a	T	G	11: 29,503,480	S1614R	probably damaging	Het
Clcn6	A	G	4: 148,010,652		probably null	Het
Cubn	A	G	2: 13,308,549	V3070A	probably benign	Het
Dst	G	A	1: 34,166,291	V1025I	possibly damaging	Het
Dusp27	A	T	1: 166,100,823	W407R	probably benign	Het
Elk3	T	A	10: 93,265,677	I71F	probably damaging	Het
Flt3	A	T	5: 147,369,490	I276N	probably damaging	Het
Frem1	G	T	4: 82,913,558	T1988K	probably benign	Het
Gm597	A	T	1: 28,778,153	V266D	probably damaging	Het
Golph3l	T	A	3: 95,617,357	D306E	probably benign	Het
Grk2	T	A	19: 4,290,670	I254F	probably damaging	Het
Hgf	C	T	5: 16,576,921	T214I	probably benign	Het
Hoxc5	C	A	15: 103,014,382		probably null	Het
Hsd11b1	T	C	1: 193,240,378	T124A	probably benign	Het
Ipp	A	G	4: 116,515,368	Y198C	probably benign	Het
Ism1	T	A	2: 139,740,127		probably null	Het
Klhl42	A	G	6: 147,091,896	Y122C	possibly damaging	Het
Klk1b21	A	T	7: 44,105,994	K206*	probably null	Het
Lcn11	A	G	2: 25,778,085	K85R	probably benign	Het
Macf1	G	T	4: 123,472,730	A2746E	probably damaging	Het
Matn4	A	G	2: 164,400,653	V175A	probably damaging	Het
Myh2	A	T	11: 67,191,719	N1372Y	probably damaging	Het
Ncl	A	G	1: 86,356,955		probably null	Het
Nudt2	A	G	4: 41,480,255	D46G	probably damaging	Het
Obscn	C	T	11: 59,067,174	D3567N	probably benign	Het
Olfr1245	A	T	2: 89,574,961	M255K	possibly damaging	Het
Olfr346	G	C	2: 36,688,475	V158L	probably benign	Het
Olfr373	G	T	8: 72,100,086	V109F	possibly damaging	Het
Pamr1	T	A	2: 102,634,535	M343K	probably benign	Het
Pcdh15	T	G	10: 74,631,193	S1684A	possibly damaging	Het
Ppm1h	T	A	10: 122,878,528	L324*	probably null	Het
Ppp3r2	T	C	4: 49,681,723	I76V	probably benign	Het
Prkdc	G	A	16: 15,677,009	V748I	probably benign	Het
Prss47	A	G	13: 65,051,777	V96A	probably benign	Het
Rsbn1	C	T	3: 103,914,473	T8I	probably benign	Het
Rsf1	GGCG	GGCGACGGCGGCG	7: 97,579,906		probably benign	Het
Serpinb3d	A	G	1: 107,078,452	V302A	probably benign	Het
Sfrp4	A	T	13: 19,632,326	I177F	probably benign	Het
Sh3bp2	A	G	5: 34,544,225		probably benign	Het
Slc7a12	A	G	3: 14,497,333	T257A	probably damaging	Het
Specc1l	T	C	10: 75,267,591		probably null	Het
Stard9	A	G	2: 120,704,235	T3658A	probably benign	Het
Tctex1d4	A	G	4: 117,128,307	E109G	possibly damaging	Het
Tmem2	G	A	19: 21,844,750	A1170T	possibly damaging	Het
Tmem30c	T	C	16: 57,281,362	T68A	probably damaging	Het
Tnr	A	G	1: 159,852,022	I189V	probably benign	Het
Trrap	A	G	5: 144,853,488	N3586S	possibly damaging	Het
Usp14	T	C	18: 10,024,632	T22A	probably damaging	Het
Vmn1r68	A	G	7: 10,527,991	L60P	probably damaging	Het
Vmn2r108	G	A	17: 20,470,990	H424Y	probably benign	Het
Wdr81	C	A	11: 75,445,962	E1534*	probably null	Het
Zc3h13	A	G	14: 75,330,195	E976G	probably damaging	Het
Zfp128	T	C	7: 12,890,029	L108P	possibly damaging	Het

Other mutations in Zfp644

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00963:Zfp644	APN	5	106638637	critical splice acceptor site	probably null
IGL01654:Zfp644	APN	5	106635930	missense	probably damaging	1.00
IGL01967:Zfp644	APN	5	106638243	missense	probably damaging	1.00
IGL02132:Zfp644	APN	5	106635894	missense	probably benign	0.22
IGL02164:Zfp644	APN	5	106638099	missense	probably benign	0.01
IGL02303:Zfp644	APN	5	106637314	missense	probably damaging	1.00
IGL03091:Zfp644	APN	5	106636858	missense	probably damaging	1.00
IGL03102:Zfp644	APN	5	106637268	missense	probably damaging	0.99
IGL03298:Zfp644	APN	5	106635101	missense	possibly damaging	0.93
PIT4466001:Zfp644	UTSW	5	106636477	missense	probably damaging	0.99
R0012:Zfp644	UTSW	5	106635043	missense	probably benign	0.11
R0012:Zfp644	UTSW	5	106635043	missense	probably benign	0.11
R0038:Zfp644	UTSW	5	106635043	missense	probably benign	0.11
R0038:Zfp644	UTSW	5	106635043	missense	probably benign	0.11
R0058:Zfp644	UTSW	5	106637003	missense	possibly damaging	0.69
R0058:Zfp644	UTSW	5	106637003	missense	possibly damaging	0.69
R0178:Zfp644	UTSW	5	106636905	missense	probably damaging	1.00
R0497:Zfp644	UTSW	5	106638333	missense	probably damaging	0.99
R1302:Zfp644	UTSW	5	106634899	missense	probably damaging	1.00
R1337:Zfp644	UTSW	5	106637554	missense	probably damaging	0.99
R1400:Zfp644	UTSW	5	106637470	splice site	probably null
R1597:Zfp644	UTSW	5	106638333	missense	probably damaging	0.99
R1911:Zfp644	UTSW	5	106635271	missense	possibly damaging	0.95
R2196:Zfp644	UTSW	5	106638603	start codon destroyed	probably null	0.02
R2256:Zfp644	UTSW	5	106635845	missense	probably damaging	1.00
R2311:Zfp644	UTSW	5	106634956	missense	probably benign	0.21
R2420:Zfp644	UTSW	5	106637244	missense	possibly damaging	0.95
R2421:Zfp644	UTSW	5	106637244	missense	possibly damaging	0.95
R2422:Zfp644	UTSW	5	106637244	missense	possibly damaging	0.95
R3752:Zfp644	UTSW	5	106636383	missense	probably benign
R4207:Zfp644	UTSW	5	106618276	missense	probably damaging	1.00
R4285:Zfp644	UTSW	5	106635118	missense	probably damaging	1.00
R4874:Zfp644	UTSW	5	106635413	missense	probably damaging	1.00
R4961:Zfp644	UTSW	5	106618215	utr 3 prime	probably benign
R4984:Zfp644	UTSW	5	106636917	missense	possibly damaging	0.96
R5007:Zfp644	UTSW	5	106636001	missense	probably benign
R5358:Zfp644	UTSW	5	106635675	missense	probably damaging	1.00
R5382:Zfp644	UTSW	5	106634869	missense	possibly damaging	0.88
R5416:Zfp644	UTSW	5	106618428	splice site	silent
R5641:Zfp644	UTSW	5	106619595	missense	probably damaging	1.00
R5656:Zfp644	UTSW	5	106637982	missense	probably benign	0.12
R5732:Zfp644	UTSW	5	106637123	missense	probably damaging	1.00
R6039:Zfp644	UTSW	5	106635425	missense	possibly damaging	0.93
R6039:Zfp644	UTSW	5	106635425	missense	possibly damaging	0.93
R6306:Zfp644	UTSW	5	106638124	missense	probably damaging	0.99
R6317:Zfp644	UTSW	5	106635845	missense	probably damaging	1.00
R6354:Zfp644	UTSW	5	106636753	missense	probably benign	0.23
R6886:Zfp644	UTSW	5	106637911	missense	possibly damaging	0.53
R7223:Zfp644	UTSW	5	106637582	nonsense	probably null
R7326:Zfp644	UTSW	5	106638277	missense	probably benign	0.12
R7450:Zfp644	UTSW	5	106638526	missense	probably benign	0.00
R8095:Zfp644	UTSW	5	106618414	missense	possibly damaging	0.93
R8710:Zfp644	UTSW	5	106635131	missense	probably damaging	0.99
R8822:Zfp644	UTSW	5	106635221	missense	possibly damaging	0.93
R8936:Zfp644	UTSW	5	106635637	missense	probably damaging	1.00
R8975:Zfp644	UTSW	5	106637601	missense	probably benign
R9056:Zfp644	UTSW	5	106636078	nonsense	probably null
R9192:Zfp644	UTSW	5	106637963	missense	probably benign
R9250:Zfp644	UTSW	5	106636833	missense	probably damaging	0.99
R9287:Zfp644	UTSW	5	106637908	missense	possibly damaging	0.94
R9313:Zfp644	UTSW	5	106636458	missense	probably benign	0.25
R9600:Zfp644	UTSW	5	106636043	missense	probably benign
R9766:Zfp644	UTSW	5	106636825	missense	probably damaging	1.00
R9789:Zfp644	UTSW	5	106638265	missense	possibly damaging	0.91
X0011:Zfp644	UTSW	5	106618427	missense	probably damaging	1.00
Z1176:Zfp644	UTSW	5	106635744	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- GTTCGGAAGTAGTTTCAGACTTCTC -3'
(R):5'- AACCCAGAAACGCCTTTGTC -3'

Sequencing Primer
(F):5'- TTAGGCCCCAACTATCTCC -3'
(R):5'- ACGCCTTTGTCAAAGCATAGTTCTG -3'

Posted On

2014-08-25