Incidental Mutation 'R0142:Abca6'
ID22400
Institutional Source Beutler Lab
Gene Symbol Abca6
Ensembl Gene ENSMUSG00000044749
Gene NameATP-binding cassette, sub-family A (ABC1), member 6
Synonyms6330565N06Rik
MMRRC Submission 038427-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0142 (G1)
Quality Score211
Status Validated (trace)
Chromosome11
Chromosomal Location110176820-110251776 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 110188641 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 1229 (D1229A)
Ref Sequence ENSEMBL: ENSMUSP00000035458 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044003]
Predicted Effect probably damaging
Transcript: ENSMUST00000044003
AA Change: D1229A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035458
Gene: ENSMUSG00000044749
AA Change: D1229A

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 28 416 1.4e-42 PFAM
low complexity region 484 495 N/A INTRINSIC
AAA 506 691 1.13e-6 SMART
transmembrane domain 854 876 N/A INTRINSIC
transmembrane domain 971 990 N/A INTRINSIC
transmembrane domain 1005 1027 N/A INTRINSIC
Blast:AAA 1041 1176 4e-21 BLAST
transmembrane domain 1191 1213 N/A INTRINSIC
low complexity region 1243 1254 N/A INTRINSIC
AAA 1312 1505 2.43e-6 SMART
Meta Mutation Damage Score 0.3497 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 87.6%
Validation Efficiency 92% (61/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This encoded protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This gene is clustered among 4 other ABC1 family members on 17q24 and may play a role in macrophage lipid homeostasis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A G 19: 29,718,254 S1347P possibly damaging Het
Abhd8 A C 8: 71,461,862 F41V probably damaging Het
Ago4 T G 4: 126,516,932 E222A probably benign Het
Ap3b2 T C 7: 81,473,080 I470V probably damaging Het
Bcl9l C T 9: 44,507,112 T749M probably benign Het
Bicc1 T C 10: 70,925,370 K937E probably damaging Het
Bmi1 G A 2: 18,683,284 probably null Het
Boc A C 16: 44,490,241 I772S probably damaging Het
C2 T A 17: 34,873,528 I178F possibly damaging Het
Cacna1c G T 6: 118,603,882 A1416E probably damaging Het
Chst10 A G 1: 38,871,729 L118P probably damaging Het
Crybg1 G A 10: 43,999,063 T683I possibly damaging Het
Cul5 C T 9: 53,635,050 V314I probably damaging Het
Dnajc17 C A 2: 119,179,934 R211I probably benign Het
Emilin1 A G 5: 30,913,920 T16A probably benign Het
Ercc6l2 A C 13: 63,872,506 probably benign Het
Fsd2 T A 7: 81,559,935 D53V probably damaging Het
Galnt13 A G 2: 55,098,603 D479G probably damaging Het
Grk3 A T 5: 112,915,053 W643R probably damaging Het
Hdgf G A 3: 87,913,109 A4T possibly damaging Het
Hnrnpr T A 4: 136,327,282 V182E probably damaging Het
Ipo13 A C 4: 117,905,569 L279R probably damaging Het
Itga9 C A 9: 118,636,586 N169K probably damaging Het
Jph3 A G 8: 121,753,371 T263A possibly damaging Het
Jph4 G T 14: 55,108,326 Q625K probably benign Het
Kctd3 A C 1: 188,996,398 probably null Het
Kif26b A T 1: 178,915,389 S570C probably damaging Het
Klhl5 G A 5: 65,143,350 W164* probably null Het
Lacc1 A T 14: 77,030,799 H357Q probably benign Het
Lama2 A G 10: 27,187,845 I1316T probably benign Het
Lcp2 C T 11: 34,082,418 P332L probably damaging Het
Map3k6 A T 4: 133,250,946 H1033L probably benign Het
Mfsd2b A G 12: 4,866,234 V252A probably benign Het
Myo16 T A 8: 10,569,790 I1447N probably benign Het
Myo19 G A 11: 84,894,603 R224H probably damaging Het
Myo5a C T 9: 75,160,574 H637Y probably benign Het
Nek10 C T 14: 14,861,560 R539C possibly damaging Het
Nfix A T 8: 84,721,686 V404E probably damaging Het
Nr1i2 T C 16: 38,253,006 R203G probably benign Het
Nup210l G A 3: 90,172,113 G968D probably damaging Het
Olfr1494 A T 19: 13,749,255 I50F probably benign Het
Olfr697 G T 7: 106,741,765 H56Q probably benign Het
Olfr884 A T 9: 38,048,110 H296L probably benign Het
Phlpp2 C T 8: 109,907,513 R242W probably damaging Het
Plcz1 A G 6: 140,007,697 F398S probably damaging Het
Ppfibp2 C A 7: 107,744,177 P808T probably damaging Het
Srpk2 T C 5: 23,527,930 K239E probably damaging Het
Svep1 A G 4: 58,118,232 V830A probably benign Het
Tesc A T 5: 118,056,570 I149F possibly damaging Het
Thsd7a A G 6: 12,418,335 W632R probably damaging Het
Tmprss9 A G 10: 80,894,378 D704G possibly damaging Het
Tob1 T C 11: 94,214,597 Y320H probably damaging Het
Trpm3 G T 19: 22,987,916 D1582Y probably damaging Het
Ttc28 A G 5: 111,277,457 K1716R probably benign Het
Uqcrfs1 A G 13: 30,540,942 V205A probably benign Het
Usp29 G A 7: 6,962,335 M392I probably benign Het
Uspl1 A T 5: 149,188,349 Y22F possibly damaging Het
Virma C A 4: 11,548,783 N1780K probably benign Het
Vmn1r56 C T 7: 5,196,373 A82T probably benign Het
Vmn2r5 A T 3: 64,492,588 C553S probably damaging Het
Vwce A T 19: 10,664,612 R901W probably damaging Het
Wdpcp C A 11: 21,857,444 probably null Het
Zfp423 A T 8: 87,780,340 C1000* probably null Het
Zscan20 A G 4: 128,585,837 F954L probably benign Het
Other mutations in Abca6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Abca6 APN 11 110184709 missense probably damaging 1.00
IGL00569:Abca6 APN 11 110187049 missense possibly damaging 0.88
IGL00737:Abca6 APN 11 110196997 splice site probably benign
IGL01024:Abca6 APN 11 110197142 missense probably benign
IGL01087:Abca6 APN 11 110191650 missense probably benign 0.00
IGL01511:Abca6 APN 11 110244310 missense probably benign 0.00
IGL01516:Abca6 APN 11 110218217 missense possibly damaging 0.70
IGL01621:Abca6 APN 11 110184708 missense probably damaging 1.00
IGL01749:Abca6 APN 11 110244224 missense probably damaging 1.00
IGL01934:Abca6 APN 11 110188655 missense probably benign 0.00
IGL02010:Abca6 APN 11 110219616 missense probably benign 0.12
IGL02121:Abca6 APN 11 110182924 missense probably benign 0.38
IGL02423:Abca6 APN 11 110219006 splice site probably benign
IGL02428:Abca6 APN 11 110178792 missense possibly damaging 0.81
IGL02491:Abca6 APN 11 110176968 utr 3 prime probably benign
IGL02541:Abca6 APN 11 110212267 missense probably damaging 1.00
IGL02792:Abca6 APN 11 110188681 missense probably damaging 0.99
IGL02836:Abca6 APN 11 110248548 missense probably damaging 1.00
IGL02965:Abca6 APN 11 110180613 missense probably benign
IGL03094:Abca6 APN 11 110184112 missense probably benign 0.03
IGL03109:Abca6 APN 11 110180347 missense probably damaging 0.96
R0068:Abca6 UTSW 11 110182882 missense probably damaging 1.00
R0165:Abca6 UTSW 11 110219604 missense possibly damaging 0.90
R0254:Abca6 UTSW 11 110236789 missense probably benign 0.16
R0598:Abca6 UTSW 11 110197154 missense probably damaging 1.00
R0992:Abca6 UTSW 11 110211684 missense probably damaging 1.00
R1386:Abca6 UTSW 11 110244255 missense probably benign 0.02
R1642:Abca6 UTSW 11 110218281 missense possibly damaging 0.73
R1673:Abca6 UTSW 11 110212339 missense probably benign 0.01
R1792:Abca6 UTSW 11 110184044 missense probably benign 0.00
R1813:Abca6 UTSW 11 110233845 splice site probably benign
R1817:Abca6 UTSW 11 110219318 missense probably benign 0.00
R1842:Abca6 UTSW 11 110197039 missense probably benign 0.00
R1898:Abca6 UTSW 11 110208799 missense probably damaging 0.99
R1914:Abca6 UTSW 11 110212210 missense probably benign 0.06
R1915:Abca6 UTSW 11 110212210 missense probably benign 0.06
R1934:Abca6 UTSW 11 110210083 critical splice donor site probably null
R1964:Abca6 UTSW 11 110184676 missense probably damaging 0.98
R1967:Abca6 UTSW 11 110187148 missense probably benign 0.09
R2127:Abca6 UTSW 11 110219649 missense probably benign 0.00
R2128:Abca6 UTSW 11 110219649 missense probably benign 0.00
R2164:Abca6 UTSW 11 110210193 frame shift probably null
R2895:Abca6 UTSW 11 110202426 missense probably benign 0.00
R3110:Abca6 UTSW 11 110178829 nonsense probably null
R3111:Abca6 UTSW 11 110178829 nonsense probably null
R3112:Abca6 UTSW 11 110178829 nonsense probably null
R4094:Abca6 UTSW 11 110180366 missense probably damaging 1.00
R4432:Abca6 UTSW 11 110241588 missense probably benign 0.11
R4474:Abca6 UTSW 11 110233772 missense possibly damaging 0.46
R4572:Abca6 UTSW 11 110216548 missense probably benign 0.31
R4629:Abca6 UTSW 11 110230549 critical splice acceptor site probably null
R4793:Abca6 UTSW 11 110191718 missense probably benign
R4852:Abca6 UTSW 11 110244203 missense probably benign 0.09
R4867:Abca6 UTSW 11 110202379 missense probably benign 0.01
R4879:Abca6 UTSW 11 110219700 missense probably damaging 0.98
R4918:Abca6 UTSW 11 110180551 missense probably damaging 1.00
R5060:Abca6 UTSW 11 110219604 missense possibly damaging 0.90
R5062:Abca6 UTSW 11 110177066 missense probably benign 0.12
R5083:Abca6 UTSW 11 110218967 missense probably damaging 1.00
R5173:Abca6 UTSW 11 110191720 missense probably benign
R5393:Abca6 UTSW 11 110244295 missense probably benign 0.00
R5484:Abca6 UTSW 11 110184073 missense probably damaging 1.00
R5498:Abca6 UTSW 11 110208844 missense possibly damaging 0.95
R5503:Abca6 UTSW 11 110218257 missense probably damaging 1.00
R5645:Abca6 UTSW 11 110250408 missense probably damaging 0.99
R5680:Abca6 UTSW 11 110236645 missense possibly damaging 0.88
R5761:Abca6 UTSW 11 110210101 missense probably damaging 1.00
R5779:Abca6 UTSW 11 110184670 missense probably benign 0.37
R5818:Abca6 UTSW 11 110219643 missense probably damaging 1.00
R6282:Abca6 UTSW 11 110208824 missense probably damaging 0.98
R6455:Abca6 UTSW 11 110241581 missense probably damaging 1.00
R6826:Abca6 UTSW 11 110216605 missense probably benign 0.15
R6857:Abca6 UTSW 11 110219688 missense possibly damaging 0.63
R6914:Abca6 UTSW 11 110190238 missense probably benign
R6931:Abca6 UTSW 11 110244328 missense probably benign 0.27
R7222:Abca6 UTSW 11 110191693 missense probably benign 0.29
R7242:Abca6 UTSW 11 110241653 missense possibly damaging 0.47
R7297:Abca6 UTSW 11 110183026 critical splice donor site probably null
R7387:Abca6 UTSW 11 110202420 missense probably benign
R7420:Abca6 UTSW 11 110250477 missense probably benign 0.24
R7494:Abca6 UTSW 11 110208745 missense possibly damaging 0.93
R7603:Abca6 UTSW 11 110180258 missense possibly damaging 0.69
R7637:Abca6 UTSW 11 110218952 missense probably benign 0.00
R7674:Abca6 UTSW 11 110219297 missense probably damaging 1.00
R7753:Abca6 UTSW 11 110184107 missense probably damaging 1.00
R7800:Abca6 UTSW 11 110187872 missense probably benign 0.00
R7842:Abca6 UTSW 11 110196697 missense possibly damaging 0.76
R7855:Abca6 UTSW 11 110191628 missense probably benign 0.01
R7925:Abca6 UTSW 11 110196697 missense possibly damaging 0.76
R7938:Abca6 UTSW 11 110191628 missense probably benign 0.01
X0024:Abca6 UTSW 11 110244255 missense probably benign 0.02
X0064:Abca6 UTSW 11 110197142 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGTGGCGGGTCATAATTCTTGACAG -3'
(R):5'- GCGCGATGGGTCATTTTAAAGACAG -3'

Sequencing Primer
(F):5'- GCGGGTCATAATTCTTGACAGTAAAC -3'
(R):5'- actgggctgtaaagtgtgag -3'
Posted On2013-04-16