Incidental Mutation 'R2021:Elk3'
ID224003
Institutional Source Beutler Lab
Gene Symbol Elk3
Ensembl Gene ENSMUSG00000008398
Gene NameELK3, member of ETS oncogene family
SynonymsNet, D430049E23Rik, Erp, Sap-2
MMRRC Submission 040030-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.437) question?
Stock #R2021 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location93247414-93311135 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 93265677 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 71 (I71F)
Ref Sequence ENSEMBL: ENSMUSP00000152060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008542] [ENSMUST00000129827] [ENSMUST00000151153] [ENSMUST00000215286] [ENSMUST00000223340]
Predicted Effect probably damaging
Transcript: ENSMUST00000008542
AA Change: I71F

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000008542
Gene: ENSMUSG00000008398
AA Change: I71F

DomainStartEndE-ValueType
ETS 4 89 1.56e-55 SMART
low complexity region 200 222 N/A INTRINSIC
low complexity region 229 256 N/A INTRINSIC
low complexity region 278 299 N/A INTRINSIC
low complexity region 356 367 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000129827
AA Change: I71F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122324
Gene: ENSMUSG00000008398
AA Change: I71F

DomainStartEndE-ValueType
ETS 4 89 1.56e-55 SMART
low complexity region 200 217 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151153
SMART Domains Protein: ENSMUSP00000121754
Gene: ENSMUSG00000008398

DomainStartEndE-ValueType
ETS 4 80 7.6e-36 SMART
low complexity region 89 100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000215286
Predicted Effect probably benign
Transcript: ENSMUST00000216729
Predicted Effect probably damaging
Transcript: ENSMUST00000223340
AA Change: I71F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ETS-domain transcription factor family and the ternary complex factor (TCF) subfamily. Proteins in this subfamily regulate transcription when recruited by serum response factor to bind to serum response elements. This protein is activated by signal-induced phosphorylation; studies in rodents suggest that it is a transcriptional inhibitor in the absence of Ras, but activates transcription when Ras is present. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Homozygotes for a null allele develop a vascular defect associated with lymphangiectasis and die prematurely due to respiratory failure resulting from chylothorax. Homozygotes for a different null allele show a transient delay in retinal primary plexus vascularization and tortuous retinal arteries. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T C 6: 48,931,451 S462P probably damaging Het
Ablim1 A T 19: 57,047,018 S316T probably damaging Het
Alox8 C T 11: 69,186,288 V460I probably damaging Het
Arvcf G A 16: 18,399,732 A491T probably damaging Het
Asnsd1 A G 1: 53,347,227 S414P possibly damaging Het
Btbd7 A G 12: 102,790,709 L706P probably damaging Het
Camk2d T A 3: 126,780,456 W171R probably damaging Het
Casc3 T A 11: 98,821,506 S124T probably benign Het
Casp8ap2 T C 4: 32,644,560 V1211A probably benign Het
Ccdc182 T C 11: 88,294,136 V14A possibly damaging Het
Ccdc80 A T 16: 45,122,912 Q795L probably damaging Het
Ccdc88a T G 11: 29,503,480 S1614R probably damaging Het
Clcn6 A G 4: 148,010,652 probably null Het
Cubn A G 2: 13,308,549 V3070A probably benign Het
Dst G A 1: 34,166,291 V1025I possibly damaging Het
Dusp27 A T 1: 166,100,823 W407R probably benign Het
Flt3 A T 5: 147,369,490 I276N probably damaging Het
Frem1 G T 4: 82,913,558 T1988K probably benign Het
Gm597 A T 1: 28,778,153 V266D probably damaging Het
Golph3l T A 3: 95,617,357 D306E probably benign Het
Grk2 T A 19: 4,290,670 I254F probably damaging Het
Hgf C T 5: 16,576,921 T214I probably benign Het
Hoxc5 C A 15: 103,014,382 probably null Het
Hsd11b1 T C 1: 193,240,378 T124A probably benign Het
Ipp A G 4: 116,515,368 Y198C probably benign Het
Ism1 T A 2: 139,740,127 probably null Het
Klhl42 A G 6: 147,091,896 Y122C possibly damaging Het
Klk1b21 A T 7: 44,105,994 K206* probably null Het
Lcn11 A G 2: 25,778,085 K85R probably benign Het
Macf1 G T 4: 123,472,730 A2746E probably damaging Het
Matn4 A G 2: 164,400,653 V175A probably damaging Het
Myh2 A T 11: 67,191,719 N1372Y probably damaging Het
Ncl A G 1: 86,356,955 probably null Het
Nudt2 A G 4: 41,480,255 D46G probably damaging Het
Obscn C T 11: 59,067,174 D3567N probably benign Het
Olfr1245 A T 2: 89,574,961 M255K possibly damaging Het
Olfr346 G C 2: 36,688,475 V158L probably benign Het
Olfr373 G T 8: 72,100,086 V109F possibly damaging Het
Pamr1 T A 2: 102,634,535 M343K probably benign Het
Pcdh15 T G 10: 74,631,193 S1684A possibly damaging Het
Ppm1h T A 10: 122,878,528 L324* probably null Het
Ppp3r2 T C 4: 49,681,723 I76V probably benign Het
Prkdc G A 16: 15,677,009 V748I probably benign Het
Prss47 A G 13: 65,051,777 V96A probably benign Het
Rsbn1 C T 3: 103,914,473 T8I probably benign Het
Rsf1 GGCG GGCGACGGCGGCG 7: 97,579,906 probably benign Het
Serpinb3d A G 1: 107,078,452 V302A probably benign Het
Sfrp4 A T 13: 19,632,326 I177F probably benign Het
Sh3bp2 A G 5: 34,544,225 probably benign Het
Slc7a12 A G 3: 14,497,333 T257A probably damaging Het
Specc1l T C 10: 75,267,591 probably null Het
Stard9 A G 2: 120,704,235 T3658A probably benign Het
Tctex1d4 A G 4: 117,128,307 E109G possibly damaging Het
Tmem2 G A 19: 21,844,750 A1170T possibly damaging Het
Tmem30c T C 16: 57,281,362 T68A probably damaging Het
Tnr A G 1: 159,852,022 I189V probably benign Het
Trrap A G 5: 144,853,488 N3586S possibly damaging Het
Usp14 T C 18: 10,024,632 T22A probably damaging Het
Vmn1r68 A G 7: 10,527,991 L60P probably damaging Het
Vmn2r108 G A 17: 20,470,990 H424Y probably benign Het
Wdr81 C A 11: 75,445,962 E1534* probably null Het
Zc3h13 A G 14: 75,330,195 E976G probably damaging Het
Zfp128 T C 7: 12,890,029 L108P possibly damaging Het
Zfp644 T C 5: 106,635,682 I1000V possibly damaging Het
Other mutations in Elk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00591:Elk3 APN 10 93284827 missense probably damaging 1.00
IGL02566:Elk3 APN 10 93265463 missense probably damaging 1.00
IGL03251:Elk3 APN 10 93254821 splice site probably null
R0308:Elk3 UTSW 10 93265205 missense probably benign
R0594:Elk3 UTSW 10 93265160 missense probably damaging 1.00
R0601:Elk3 UTSW 10 93265481 missense probably damaging 0.98
R1190:Elk3 UTSW 10 93265196 missense probably benign 0.00
R2022:Elk3 UTSW 10 93265677 missense probably damaging 1.00
R2418:Elk3 UTSW 10 93284827 missense probably damaging 1.00
R3935:Elk3 UTSW 10 93265173 missense possibly damaging 0.60
R4167:Elk3 UTSW 10 93265335 critical splice donor site probably null
R4168:Elk3 UTSW 10 93265335 critical splice donor site probably null
R4169:Elk3 UTSW 10 93265335 critical splice donor site probably null
R4170:Elk3 UTSW 10 93265335 critical splice donor site probably null
R5864:Elk3 UTSW 10 93284791 missense probably damaging 1.00
R6171:Elk3 UTSW 10 93250044 missense probably damaging 1.00
R6743:Elk3 UTSW 10 93265050 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- GGCTGGCACTTTTGAGAGAG -3'
(R):5'- GTCAACAGGACCAGAGTGTAAC -3'

Sequencing Primer
(F):5'- CACTTTTGAGAGAGGACAAGCC -3'
(R):5'- GAGTGTAACAGTGAACCTTCAGTCTC -3'
Posted On2014-08-25