Incidental Mutation 'R2021:Myh2'
ID224011
Institutional Source Beutler Lab
Gene Symbol Myh2
Ensembl Gene ENSMUSG00000033196
Gene Namemyosin, heavy polypeptide 2, skeletal muscle, adult
SynonymsMHC2A, Myhs-f, Myhsf1, Myhs-f1, MyHC-IIa
MMRRC Submission 040030-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.250) question?
Stock #R2021 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location67171027-67197517 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 67191719 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 1372 (N1372Y)
Ref Sequence ENSEMBL: ENSMUSP00000129544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018641] [ENSMUST00000170159]
Predicted Effect probably damaging
Transcript: ENSMUST00000018641
AA Change: N1372Y

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000018641
Gene: ENSMUSG00000033196
AA Change: N1372Y

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 2.1e-16 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 3.13e-3 SMART
IQ 813 835 3.14e2 SMART
low complexity region 850 862 N/A INTRINSIC
low complexity region 931 945 N/A INTRINSIC
Pfam:Myosin_tail_1 1075 1933 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145346
Predicted Effect probably damaging
Transcript: ENSMUST00000170159
AA Change: N1372Y

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000129544
Gene: ENSMUSG00000033196
AA Change: N1372Y

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 1.4e-14 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 3.13e-3 SMART
IQ 813 835 3.14e2 SMART
Pfam:Myosin_tail_1 850 1931 4e-166 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myosins are actin-based motor proteins that function in the generation of mechanical force in eukaryotic cells. Muscle myosins are heterohexamers composed of 2 myosin heavy chains and 2 pairs of nonidentical myosin light chains. This gene encodes a member of the class II or conventional myosin heavy chains, and functions in skeletal muscle contraction. This gene is found in a cluster of myosin heavy chain genes on chromosome 17. A mutation in this gene results in inclusion body myopathy-3. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T C 6: 48,931,451 S462P probably damaging Het
Ablim1 A T 19: 57,047,018 S316T probably damaging Het
Alox8 C T 11: 69,186,288 V460I probably damaging Het
Arvcf G A 16: 18,399,732 A491T probably damaging Het
Asnsd1 A G 1: 53,347,227 S414P possibly damaging Het
Btbd7 A G 12: 102,790,709 L706P probably damaging Het
Camk2d T A 3: 126,780,456 W171R probably damaging Het
Casc3 T A 11: 98,821,506 S124T probably benign Het
Casp8ap2 T C 4: 32,644,560 V1211A probably benign Het
Ccdc182 T C 11: 88,294,136 V14A possibly damaging Het
Ccdc80 A T 16: 45,122,912 Q795L probably damaging Het
Ccdc88a T G 11: 29,503,480 S1614R probably damaging Het
Clcn6 A G 4: 148,010,652 probably null Het
Cubn A G 2: 13,308,549 V3070A probably benign Het
Dst G A 1: 34,166,291 V1025I possibly damaging Het
Dusp27 A T 1: 166,100,823 W407R probably benign Het
Elk3 T A 10: 93,265,677 I71F probably damaging Het
Flt3 A T 5: 147,369,490 I276N probably damaging Het
Frem1 G T 4: 82,913,558 T1988K probably benign Het
Gm597 A T 1: 28,778,153 V266D probably damaging Het
Golph3l T A 3: 95,617,357 D306E probably benign Het
Grk2 T A 19: 4,290,670 I254F probably damaging Het
Hgf C T 5: 16,576,921 T214I probably benign Het
Hoxc5 C A 15: 103,014,382 probably null Het
Hsd11b1 T C 1: 193,240,378 T124A probably benign Het
Ipp A G 4: 116,515,368 Y198C probably benign Het
Ism1 T A 2: 139,740,127 probably null Het
Klhl42 A G 6: 147,091,896 Y122C possibly damaging Het
Klk1b21 A T 7: 44,105,994 K206* probably null Het
Lcn11 A G 2: 25,778,085 K85R probably benign Het
Macf1 G T 4: 123,472,730 A2746E probably damaging Het
Matn4 A G 2: 164,400,653 V175A probably damaging Het
Ncl A G 1: 86,356,955 probably null Het
Nudt2 A G 4: 41,480,255 D46G probably damaging Het
Obscn C T 11: 59,067,174 D3567N probably benign Het
Olfr1245 A T 2: 89,574,961 M255K possibly damaging Het
Olfr346 G C 2: 36,688,475 V158L probably benign Het
Olfr373 G T 8: 72,100,086 V109F possibly damaging Het
Pamr1 T A 2: 102,634,535 M343K probably benign Het
Pcdh15 T G 10: 74,631,193 S1684A possibly damaging Het
Ppm1h T A 10: 122,878,528 L324* probably null Het
Ppp3r2 T C 4: 49,681,723 I76V probably benign Het
Prkdc G A 16: 15,677,009 V748I probably benign Het
Prss47 A G 13: 65,051,777 V96A probably benign Het
Rsbn1 C T 3: 103,914,473 T8I probably benign Het
Rsf1 GGCG GGCGACGGCGGCG 7: 97,579,906 probably benign Het
Serpinb3d A G 1: 107,078,452 V302A probably benign Het
Sfrp4 A T 13: 19,632,326 I177F probably benign Het
Sh3bp2 A G 5: 34,544,225 probably benign Het
Slc7a12 A G 3: 14,497,333 T257A probably damaging Het
Specc1l T C 10: 75,267,591 probably null Het
Stard9 A G 2: 120,704,235 T3658A probably benign Het
Tctex1d4 A G 4: 117,128,307 E109G possibly damaging Het
Tmem2 G A 19: 21,844,750 A1170T possibly damaging Het
Tmem30c T C 16: 57,281,362 T68A probably damaging Het
Tnr A G 1: 159,852,022 I189V probably benign Het
Trrap A G 5: 144,853,488 N3586S possibly damaging Het
Usp14 T C 18: 10,024,632 T22A probably damaging Het
Vmn1r68 A G 7: 10,527,991 L60P probably damaging Het
Vmn2r108 G A 17: 20,470,990 H424Y probably benign Het
Wdr81 C A 11: 75,445,962 E1534* probably null Het
Zc3h13 A G 14: 75,330,195 E976G probably damaging Het
Zfp128 T C 7: 12,890,029 L108P possibly damaging Het
Zfp644 T C 5: 106,635,682 I1000V possibly damaging Het
Other mutations in Myh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Myh2 APN 11 67185233 missense possibly damaging 0.88
IGL00330:Myh2 APN 11 67193440 missense probably benign 0.06
IGL00423:Myh2 APN 11 67197345 missense probably benign
IGL00429:Myh2 APN 11 67180790 nonsense probably null
IGL00465:Myh2 APN 11 67178833 splice site probably benign
IGL00671:Myh2 APN 11 67193357 missense probably damaging 0.97
IGL00773:Myh2 APN 11 67194421 missense probably benign
IGL00821:Myh2 APN 11 67197397 utr 3 prime probably benign
IGL00900:Myh2 APN 11 67179384 missense probably damaging 1.00
IGL01374:Myh2 APN 11 67177424 missense probably benign 0.05
IGL01613:Myh2 APN 11 67197344 missense probably benign 0.01
IGL01845:Myh2 APN 11 67193034 missense probably benign 0.02
IGL01900:Myh2 APN 11 67183783 missense probably benign 0.01
IGL01936:Myh2 APN 11 67191773 missense possibly damaging 0.94
IGL02129:Myh2 APN 11 67185258 missense probably benign 0.05
IGL02172:Myh2 APN 11 67189052 missense possibly damaging 0.78
IGL02554:Myh2 APN 11 67189165 missense probably benign 0.00
IGL02578:Myh2 APN 11 67186691 missense probably benign 0.33
IGL03075:Myh2 APN 11 67180836 missense probably benign 0.39
IGL03078:Myh2 APN 11 67190430 missense probably benign
IGL03117:Myh2 APN 11 67180884 missense possibly damaging 0.91
IGL03255:Myh2 APN 11 67193225 missense probably damaging 1.00
IGL03266:Myh2 APN 11 67176324 missense probably benign
IGL03366:Myh2 APN 11 67183523 missense probably damaging 1.00
IGL03412:Myh2 APN 11 67189569 missense probably benign 0.04
limp UTSW 11 67192504 missense probably damaging 1.00
noodle UTSW 11 67186612 missense probably benign
PIT4403001:Myh2 UTSW 11 67186707 missense probably benign 0.22
PIT4508001:Myh2 UTSW 11 67185505 missense probably benign 0.00
PIT4677001:Myh2 UTSW 11 67181992 missense probably benign
R0039:Myh2 UTSW 11 67178277 missense probably damaging 1.00
R0347:Myh2 UTSW 11 67185304 splice site probably benign
R0389:Myh2 UTSW 11 67180821 missense probably damaging 1.00
R0400:Myh2 UTSW 11 67192598 splice site probably benign
R0512:Myh2 UTSW 11 67188678 missense probably damaging 1.00
R0555:Myh2 UTSW 11 67178967 missense probably damaging 1.00
R0746:Myh2 UTSW 11 67173431 missense probably benign 0.00
R0842:Myh2 UTSW 11 67179524 missense possibly damaging 0.83
R0893:Myh2 UTSW 11 67186508 missense possibly damaging 0.82
R1218:Myh2 UTSW 11 67192525 missense probably damaging 0.99
R1264:Myh2 UTSW 11 67180778 missense probably damaging 0.96
R1398:Myh2 UTSW 11 67185287 missense probably benign 0.14
R1774:Myh2 UTSW 11 67173474 missense possibly damaging 0.96
R1800:Myh2 UTSW 11 67188938 missense probably damaging 0.99
R1829:Myh2 UTSW 11 67176559 missense probably damaging 0.98
R1840:Myh2 UTSW 11 67186487 missense probably benign 0.16
R1888:Myh2 UTSW 11 67180850 missense probably damaging 0.99
R1888:Myh2 UTSW 11 67180850 missense probably damaging 0.99
R1969:Myh2 UTSW 11 67189178 missense possibly damaging 0.67
R1971:Myh2 UTSW 11 67189178 missense possibly damaging 0.67
R1985:Myh2 UTSW 11 67180914 missense possibly damaging 0.65
R2029:Myh2 UTSW 11 67194625 missense possibly damaging 0.85
R2057:Myh2 UTSW 11 67188839 critical splice donor site probably null
R2080:Myh2 UTSW 11 67174941 critical splice acceptor site probably null
R2142:Myh2 UTSW 11 67189332 missense probably damaging 1.00
R2215:Myh2 UTSW 11 67191737 missense probably benign 0.35
R2225:Myh2 UTSW 11 67193729 missense probably benign
R2274:Myh2 UTSW 11 67190358 missense possibly damaging 0.84
R3018:Myh2 UTSW 11 67179584 missense possibly damaging 0.67
R3113:Myh2 UTSW 11 67185186 missense probably damaging 1.00
R3703:Myh2 UTSW 11 67189601 missense probably benign 0.01
R4022:Myh2 UTSW 11 67179404 nonsense probably null
R4081:Myh2 UTSW 11 67190430 missense probably benign 0.11
R4191:Myh2 UTSW 11 67177400 missense possibly damaging 0.81
R4291:Myh2 UTSW 11 67181159 missense probably benign 0.01
R4292:Myh2 UTSW 11 67194897 missense possibly damaging 0.46
R4424:Myh2 UTSW 11 67192725 missense probably benign 0.01
R4524:Myh2 UTSW 11 67176270 missense probably damaging 1.00
R4578:Myh2 UTSW 11 67173258 missense possibly damaging 0.85
R4597:Myh2 UTSW 11 67189418 missense probably benign 0.01
R4641:Myh2 UTSW 11 67194694 missense probably damaging 1.00
R4672:Myh2 UTSW 11 67188477 missense probably damaging 1.00
R4673:Myh2 UTSW 11 67188477 missense probably damaging 1.00
R4804:Myh2 UTSW 11 67186502 missense possibly damaging 0.78
R4818:Myh2 UTSW 11 67176255 missense probably damaging 1.00
R4943:Myh2 UTSW 11 67197317 missense probably damaging 1.00
R4958:Myh2 UTSW 11 67192959 missense possibly damaging 0.83
R5139:Myh2 UTSW 11 67179348 missense probably damaging 1.00
R5239:Myh2 UTSW 11 67192443 missense probably benign 0.00
R5306:Myh2 UTSW 11 67186556 missense probably damaging 1.00
R5492:Myh2 UTSW 11 67180875 missense probably benign 0.20
R5503:Myh2 UTSW 11 67173449 missense probably benign
R5646:Myh2 UTSW 11 67188812 missense probably benign 0.07
R5750:Myh2 UTSW 11 67191428 missense probably benign
R5806:Myh2 UTSW 11 67181315 missense probably damaging 0.98
R5878:Myh2 UTSW 11 67192504 missense probably damaging 1.00
R5892:Myh2 UTSW 11 67185176 nonsense probably null
R5898:Myh2 UTSW 11 67192719 missense possibly damaging 0.51
R6154:Myh2 UTSW 11 67186612 missense probably benign
R6156:Myh2 UTSW 11 67181053 missense probably damaging 0.98
R6236:Myh2 UTSW 11 67190331 missense probably benign 0.00
R6349:Myh2 UTSW 11 67193003 missense probably benign 0.04
R6441:Myh2 UTSW 11 67194611 missense probably benign 0.00
R6548:Myh2 UTSW 11 67186612 missense probably benign
R6681:Myh2 UTSW 11 67178348 missense probably damaging 1.00
R6907:Myh2 UTSW 11 67193741 missense probably damaging 1.00
R6925:Myh2 UTSW 11 67193218 missense probably benign 0.00
R6969:Myh2 UTSW 11 67197266 missense probably benign
R7172:Myh2 UTSW 11 67188701 missense probably benign 0.00
R7257:Myh2 UTSW 11 67181150 missense possibly damaging 0.70
R7286:Myh2 UTSW 11 67188369 missense probably benign 0.23
R7323:Myh2 UTSW 11 67197365 missense probably benign
R7396:Myh2 UTSW 11 67194728 critical splice donor site probably null
R7468:Myh2 UTSW 11 67192542 missense probably benign 0.01
R7585:Myh2 UTSW 11 67179411 critical splice donor site probably null
R7709:Myh2 UTSW 11 67194864 missense probably benign 0.00
X0026:Myh2 UTSW 11 67175022 missense probably benign 0.10
X0065:Myh2 UTSW 11 67176259 missense probably damaging 0.99
Z1088:Myh2 UTSW 11 67180763 critical splice acceptor site probably benign
Z1088:Myh2 UTSW 11 67191449 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACCATCGTTAAGGGGACTGAG -3'
(R):5'- ACTGGATTTTAAGTCAGCAGGAG -3'

Sequencing Primer
(F):5'- ACATCTCCATAGGCCAAG -3'
(R):5'- TTTTAAGTCAGCAGGAGGTCAG -3'
Posted On2014-08-25