Incidental Mutation 'R2021:Btbd7'
ID 224025
Institutional Source Beutler Lab
Gene Symbol Btbd7
Ensembl Gene ENSMUSG00000041702
Gene Name BTB domain containing 7
Synonyms 5730507E09Rik, FUP1, E130118E17Rik
MMRRC Submission 040030-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.470) question?
Stock # R2021 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 102747056-102844730 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 102756968 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 706 (L706P)
Ref Sequence ENSEMBL: ENSMUSP00000152426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045652] [ENSMUST00000223554]
AlphaFold Q8CFE5
Predicted Effect probably damaging
Transcript: ENSMUST00000045652
AA Change: L706P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046951
Gene: ENSMUSG00000041702
AA Change: L706P

DomainStartEndE-ValueType
BTB 142 244 1.57e-13 SMART
BTB 247 397 2.23e-4 SMART
BACK 402 538 1.49e-4 SMART
low complexity region 626 640 N/A INTRINSIC
low complexity region 756 771 N/A INTRINSIC
low complexity region 783 792 N/A INTRINSIC
low complexity region 808 822 N/A INTRINSIC
low complexity region 839 850 N/A INTRINSIC
low complexity region 1076 1088 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000223554
AA Change: L706P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 A T 19: 57,035,450 (GRCm39) S316T probably damaging Het
Alox8 C T 11: 69,077,114 (GRCm39) V460I probably damaging Het
Aoc1l2 T C 6: 48,908,385 (GRCm39) S462P probably damaging Het
Arvcf G A 16: 18,218,482 (GRCm39) A491T probably damaging Het
Asnsd1 A G 1: 53,386,386 (GRCm39) S414P possibly damaging Het
Camk2d T A 3: 126,574,105 (GRCm39) W171R probably damaging Het
Casc3 T A 11: 98,712,332 (GRCm39) S124T probably benign Het
Casp8ap2 T C 4: 32,644,560 (GRCm39) V1211A probably benign Het
Ccdc182 T C 11: 88,184,962 (GRCm39) V14A possibly damaging Het
Ccdc80 A T 16: 44,943,275 (GRCm39) Q795L probably damaging Het
Ccdc88a T G 11: 29,453,480 (GRCm39) S1614R probably damaging Het
Cemip2 G A 19: 21,822,114 (GRCm39) A1170T possibly damaging Het
Clcn6 A G 4: 148,095,109 (GRCm39) probably null Het
Cubn A G 2: 13,313,360 (GRCm39) V3070A probably benign Het
Dst G A 1: 34,205,372 (GRCm39) V1025I possibly damaging Het
Dynlt4 A G 4: 116,985,504 (GRCm39) E109G possibly damaging Het
Elk3 T A 10: 93,101,539 (GRCm39) I71F probably damaging Het
Flt3 A T 5: 147,306,300 (GRCm39) I276N probably damaging Het
Frem1 G T 4: 82,831,795 (GRCm39) T1988K probably benign Het
Golph3l T A 3: 95,524,668 (GRCm39) D306E probably benign Het
Grk2 T A 19: 4,340,698 (GRCm39) I254F probably damaging Het
Hgf C T 5: 16,781,919 (GRCm39) T214I probably benign Het
Hoxc5 C A 15: 102,922,814 (GRCm39) probably null Het
Hsd11b1 T C 1: 192,922,686 (GRCm39) T124A probably benign Het
Ipp A G 4: 116,372,565 (GRCm39) Y198C probably benign Het
Ism1 T A 2: 139,582,047 (GRCm39) probably null Het
Klhl42 A G 6: 146,993,394 (GRCm39) Y122C possibly damaging Het
Klk1b21 A T 7: 43,755,418 (GRCm39) K206* probably null Het
Lcn11 A G 2: 25,668,097 (GRCm39) K85R probably benign Het
Macf1 G T 4: 123,366,523 (GRCm39) A2746E probably damaging Het
Matn4 A G 2: 164,242,573 (GRCm39) V175A probably damaging Het
Myh2 A T 11: 67,082,545 (GRCm39) N1372Y probably damaging Het
Ncl A G 1: 86,284,677 (GRCm39) probably null Het
Nudt2 A G 4: 41,480,255 (GRCm39) D46G probably damaging Het
Obscn C T 11: 58,958,000 (GRCm39) D3567N probably benign Het
Or1j17 G C 2: 36,578,487 (GRCm39) V158L probably benign Het
Or2z9 G T 8: 72,853,930 (GRCm39) V109F possibly damaging Het
Or4a72 A T 2: 89,405,305 (GRCm39) M255K possibly damaging Het
Pamr1 T A 2: 102,464,880 (GRCm39) M343K probably benign Het
Pcdh15 T G 10: 74,467,025 (GRCm39) S1684A possibly damaging Het
Ppm1h T A 10: 122,714,433 (GRCm39) L324* probably null Het
Ppp3r2 T C 4: 49,681,723 (GRCm39) I76V probably benign Het
Prkdc G A 16: 15,494,873 (GRCm39) V748I probably benign Het
Prss47 A G 13: 65,199,591 (GRCm39) V96A probably benign Het
Rsbn1 C T 3: 103,821,789 (GRCm39) T8I probably benign Het
Rsf1 GGCG GGCGACGGCGGCG 7: 97,229,113 (GRCm39) probably benign Het
Serpinb3d A G 1: 107,006,182 (GRCm39) V302A probably benign Het
Sfrp4 A T 13: 19,816,496 (GRCm39) I177F probably benign Het
Sh3bp2 A G 5: 34,701,569 (GRCm39) probably benign Het
Slc7a12 A G 3: 14,562,393 (GRCm39) T257A probably damaging Het
Spata31e5 A T 1: 28,817,234 (GRCm39) V266D probably damaging Het
Specc1l T C 10: 75,103,425 (GRCm39) probably null Het
Stard9 A G 2: 120,534,716 (GRCm39) T3658A probably benign Het
Styxl2 A T 1: 165,928,392 (GRCm39) W407R probably benign Het
Tmem30c T C 16: 57,101,725 (GRCm39) T68A probably damaging Het
Tnr A G 1: 159,679,592 (GRCm39) I189V probably benign Het
Trrap A G 5: 144,790,298 (GRCm39) N3586S possibly damaging Het
Usp14 T C 18: 10,024,632 (GRCm39) T22A probably damaging Het
Vmn1r68 A G 7: 10,261,918 (GRCm39) L60P probably damaging Het
Vmn2r108 G A 17: 20,691,252 (GRCm39) H424Y probably benign Het
Wdr81 C A 11: 75,336,788 (GRCm39) E1534* probably null Het
Zc3h13 A G 14: 75,567,635 (GRCm39) E976G probably damaging Het
Zfp128 T C 7: 12,623,956 (GRCm39) L108P possibly damaging Het
Zfp644 T C 5: 106,783,548 (GRCm39) I1000V possibly damaging Het
Other mutations in Btbd7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02047:Btbd7 APN 12 102,760,038 (GRCm39) missense probably benign 0.10
IGL02899:Btbd7 APN 12 102,803,921 (GRCm39) missense probably damaging 1.00
IGL03204:Btbd7 APN 12 102,774,239 (GRCm39) nonsense probably null
H8562:Btbd7 UTSW 12 102,754,561 (GRCm39) missense probably benign 0.26
IGL03050:Btbd7 UTSW 12 102,779,065 (GRCm39) missense probably benign 0.03
R1262:Btbd7 UTSW 12 102,754,210 (GRCm39) missense probably benign
R1423:Btbd7 UTSW 12 102,751,734 (GRCm39) missense possibly damaging 0.49
R1437:Btbd7 UTSW 12 102,754,349 (GRCm39) missense possibly damaging 0.59
R1636:Btbd7 UTSW 12 102,760,110 (GRCm39) missense probably damaging 1.00
R1641:Btbd7 UTSW 12 102,757,034 (GRCm39) missense probably damaging 1.00
R1722:Btbd7 UTSW 12 102,778,913 (GRCm39) missense possibly damaging 0.96
R1921:Btbd7 UTSW 12 102,760,055 (GRCm39) missense probably benign 0.01
R2180:Btbd7 UTSW 12 102,752,156 (GRCm39) missense probably damaging 1.00
R3768:Btbd7 UTSW 12 102,761,451 (GRCm39) missense probably damaging 1.00
R3770:Btbd7 UTSW 12 102,761,451 (GRCm39) missense probably damaging 1.00
R3786:Btbd7 UTSW 12 102,804,411 (GRCm39) missense probably benign 0.22
R4396:Btbd7 UTSW 12 102,751,552 (GRCm39) missense probably benign 0.00
R4809:Btbd7 UTSW 12 102,760,003 (GRCm39) critical splice donor site probably null
R4910:Btbd7 UTSW 12 102,774,307 (GRCm39) missense probably damaging 0.98
R4915:Btbd7 UTSW 12 102,804,046 (GRCm39) nonsense probably null
R5054:Btbd7 UTSW 12 102,804,471 (GRCm39) missense probably benign 0.02
R5276:Btbd7 UTSW 12 102,804,651 (GRCm39) missense probably benign 0.00
R5387:Btbd7 UTSW 12 102,804,044 (GRCm39) missense probably damaging 0.99
R5665:Btbd7 UTSW 12 102,751,456 (GRCm39) missense probably benign
R7083:Btbd7 UTSW 12 102,754,594 (GRCm39) missense probably damaging 0.99
R7354:Btbd7 UTSW 12 102,804,464 (GRCm39) missense probably benign 0.05
R7429:Btbd7 UTSW 12 102,804,039 (GRCm39) missense probably damaging 1.00
R7462:Btbd7 UTSW 12 102,803,981 (GRCm39) missense possibly damaging 0.88
R7469:Btbd7 UTSW 12 102,779,027 (GRCm39) missense probably damaging 0.99
R7998:Btbd7 UTSW 12 102,761,499 (GRCm39) missense probably damaging 1.00
R8499:Btbd7 UTSW 12 102,754,631 (GRCm39) missense probably damaging 1.00
R8773:Btbd7 UTSW 12 102,804,241 (GRCm39) missense probably benign 0.02
R8783:Btbd7 UTSW 12 102,754,501 (GRCm39) missense probably benign 0.45
R8968:Btbd7 UTSW 12 102,779,025 (GRCm39) missense probably damaging 1.00
R9016:Btbd7 UTSW 12 102,751,417 (GRCm39) missense probably damaging 1.00
R9027:Btbd7 UTSW 12 102,804,838 (GRCm39) missense probably damaging 1.00
R9216:Btbd7 UTSW 12 102,761,563 (GRCm39) missense probably damaging 1.00
R9221:Btbd7 UTSW 12 102,777,430 (GRCm39) missense probably damaging 1.00
R9471:Btbd7 UTSW 12 102,760,145 (GRCm39) missense probably damaging 1.00
X0024:Btbd7 UTSW 12 102,778,945 (GRCm39) nonsense probably null
X0025:Btbd7 UTSW 12 102,777,423 (GRCm39) missense probably benign 0.06
Z1177:Btbd7 UTSW 12 102,777,379 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCTGCTCTACCAAGTTGTC -3'
(R):5'- GCTTGCTGAGTAGTCTTACGTAGC -3'

Sequencing Primer
(F):5'- ACCAAGTTGTCTCTCATCAGGAG -3'
(R):5'- ACGTAGCTCAGGAATTGTCC -3'
Posted On 2014-08-25