Incidental Mutation 'R2021:Prss47'
ID224029
Institutional Source Beutler Lab
Gene Symbol Prss47
Ensembl Gene ENSMUSG00000090658
Gene Nameprotease, serine 47
SynonymsGm274, LOC218304
MMRRC Submission 040030-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R2021 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location65044606-65052760 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65051777 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 96 (V96A)
Ref Sequence ENSEMBL: ENSMUSP00000145196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000182457] [ENSMUST00000203968] [ENSMUST00000222769]
Predicted Effect probably benign
Transcript: ENSMUST00000168201
AA Change: V24A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000129006
Gene: ENSMUSG00000090658
AA Change: V24A

DomainStartEndE-ValueType
Tryp_SPc 26 264 1.5e-78 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182457
AA Change: V24A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000145271
Gene: ENSMUSG00000090658
AA Change: V24A

DomainStartEndE-ValueType
Tryp_SPc 26 264 1.5e-78 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203968
AA Change: V96A

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000145196
Gene: ENSMUSG00000090658
AA Change: V96A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Tryp_SPc 98 336 3.13e-76 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220767
Predicted Effect probably benign
Transcript: ENSMUST00000222769
AA Change: V2A

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T C 6: 48,931,451 S462P probably damaging Het
Ablim1 A T 19: 57,047,018 S316T probably damaging Het
Alox8 C T 11: 69,186,288 V460I probably damaging Het
Arvcf G A 16: 18,399,732 A491T probably damaging Het
Asnsd1 A G 1: 53,347,227 S414P possibly damaging Het
Btbd7 A G 12: 102,790,709 L706P probably damaging Het
Camk2d T A 3: 126,780,456 W171R probably damaging Het
Casc3 T A 11: 98,821,506 S124T probably benign Het
Casp8ap2 T C 4: 32,644,560 V1211A probably benign Het
Ccdc182 T C 11: 88,294,136 V14A possibly damaging Het
Ccdc80 A T 16: 45,122,912 Q795L probably damaging Het
Ccdc88a T G 11: 29,503,480 S1614R probably damaging Het
Clcn6 A G 4: 148,010,652 probably null Het
Cubn A G 2: 13,308,549 V3070A probably benign Het
Dst G A 1: 34,166,291 V1025I possibly damaging Het
Dusp27 A T 1: 166,100,823 W407R probably benign Het
Elk3 T A 10: 93,265,677 I71F probably damaging Het
Flt3 A T 5: 147,369,490 I276N probably damaging Het
Frem1 G T 4: 82,913,558 T1988K probably benign Het
Gm597 A T 1: 28,778,153 V266D probably damaging Het
Golph3l T A 3: 95,617,357 D306E probably benign Het
Grk2 T A 19: 4,290,670 I254F probably damaging Het
Hgf C T 5: 16,576,921 T214I probably benign Het
Hoxc5 C A 15: 103,014,382 probably null Het
Hsd11b1 T C 1: 193,240,378 T124A probably benign Het
Ipp A G 4: 116,515,368 Y198C probably benign Het
Ism1 T A 2: 139,740,127 probably null Het
Klhl42 A G 6: 147,091,896 Y122C possibly damaging Het
Klk1b21 A T 7: 44,105,994 K206* probably null Het
Lcn11 A G 2: 25,778,085 K85R probably benign Het
Macf1 G T 4: 123,472,730 A2746E probably damaging Het
Matn4 A G 2: 164,400,653 V175A probably damaging Het
Myh2 A T 11: 67,191,719 N1372Y probably damaging Het
Ncl A G 1: 86,356,955 probably null Het
Nudt2 A G 4: 41,480,255 D46G probably damaging Het
Obscn C T 11: 59,067,174 D3567N probably benign Het
Olfr1245 A T 2: 89,574,961 M255K possibly damaging Het
Olfr346 G C 2: 36,688,475 V158L probably benign Het
Olfr373 G T 8: 72,100,086 V109F possibly damaging Het
Pamr1 T A 2: 102,634,535 M343K probably benign Het
Pcdh15 T G 10: 74,631,193 S1684A possibly damaging Het
Ppm1h T A 10: 122,878,528 L324* probably null Het
Ppp3r2 T C 4: 49,681,723 I76V probably benign Het
Prkdc G A 16: 15,677,009 V748I probably benign Het
Rsbn1 C T 3: 103,914,473 T8I probably benign Het
Rsf1 GGCG GGCGACGGCGGCG 7: 97,579,906 probably benign Het
Serpinb3d A G 1: 107,078,452 V302A probably benign Het
Sfrp4 A T 13: 19,632,326 I177F probably benign Het
Sh3bp2 A G 5: 34,544,225 probably benign Het
Slc7a12 A G 3: 14,497,333 T257A probably damaging Het
Specc1l T C 10: 75,267,591 probably null Het
Stard9 A G 2: 120,704,235 T3658A probably benign Het
Tctex1d4 A G 4: 117,128,307 E109G possibly damaging Het
Tmem2 G A 19: 21,844,750 A1170T possibly damaging Het
Tmem30c T C 16: 57,281,362 T68A probably damaging Het
Tnr A G 1: 159,852,022 I189V probably benign Het
Trrap A G 5: 144,853,488 N3586S possibly damaging Het
Usp14 T C 18: 10,024,632 T22A probably damaging Het
Vmn1r68 A G 7: 10,527,991 L60P probably damaging Het
Vmn2r108 G A 17: 20,470,990 H424Y probably benign Het
Wdr81 C A 11: 75,445,962 E1534* probably null Het
Zc3h13 A G 14: 75,330,195 E976G probably damaging Het
Zfp128 T C 7: 12,890,029 L108P possibly damaging Het
Zfp644 T C 5: 106,635,682 I1000V possibly damaging Het
Other mutations in Prss47
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0900:Prss47 UTSW 13 65049394 missense possibly damaging 0.72
R1113:Prss47 UTSW 13 65051816 missense probably benign 0.00
R1308:Prss47 UTSW 13 65051816 missense probably benign 0.00
R1472:Prss47 UTSW 13 65049289 missense probably damaging 1.00
R1561:Prss47 UTSW 13 65046248 missense probably damaging 0.97
R2165:Prss47 UTSW 13 65045073 missense probably damaging 0.98
R5655:Prss47 UTSW 13 65045043 missense probably damaging 1.00
R6044:Prss47 UTSW 13 65049306 nonsense probably null
R6395:Prss47 UTSW 13 65049302 missense probably benign 0.05
R7196:Prss47 UTSW 13 65044826 missense probably benign 0.08
R7250:Prss47 UTSW 13 65052541 missense probably benign 0.10
R7394:Prss47 UTSW 13 65044993 missense probably benign 0.11
R7443:Prss47 UTSW 13 65049489 missense probably damaging 1.00
Z1177:Prss47 UTSW 13 65051763 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTGAGGGCTCCTGATAAAGC -3'
(R):5'- TGTCAGTGAAAGCAGAGACC -3'

Sequencing Primer
(F):5'- TGAGGGCTCCTGATAAAGCAAACTC -3'
(R):5'- GAGTTGCCTGAAGTCATCTACAC -3'
Posted On2014-08-25