Mutagenetix > Incidental Mutation

Incidental Mutation 'R2021:Zc3h13'

224031

Institutional Source

Beutler Lab

Gene Symbol

Zc3h13

Ensembl Gene

ENSMUSG00000022000

Gene Name

zinc finger CCCH type containing 13

Synonyms

4930570G11Rik, 3110050K21Rik, 2600010B19Rik, C87618

MMRRC Submission

040030-MU

Accession Numbers

Genbank: NM_026083

Essential gene?

Probably essential (E-score: 0.967) question?

Stock #

R2021 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

75284373-75344426 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 75330195 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 976 (E976G)

Ref Sequence

ENSEMBL: ENSMUSP00000022577 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022577] [ENSMUST00000227049]

AlphaFold

E9Q784

Predicted Effect

probably damaging
Transcript: ENSMUST00000022577
AA Change: E976G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000022577
Gene: ENSMUSG00000022000
AA Change: E976G

Domain	Start	End	E-Value	Type
ZnF_C3H1	36	63	4.54e-4	SMART
low complexity region	136	145	N/A	INTRINSIC
coiled coil region	162	197	N/A	INTRINSIC
low complexity region	204	233	N/A	INTRINSIC
low complexity region	261	269	N/A	INTRINSIC
low complexity region	278	287	N/A	INTRINSIC
low complexity region	321	357	N/A	INTRINSIC
low complexity region	411	478	N/A	INTRINSIC
low complexity region	482	493	N/A	INTRINSIC
low complexity region	496	575	N/A	INTRINSIC
low complexity region	684	701	N/A	INTRINSIC
coiled coil region	706	865	N/A	INTRINSIC
low complexity region	907	918	N/A	INTRINSIC
internal_repeat_1	921	948	1.8e-6	PROSPERO
low complexity region	964	985	N/A	INTRINSIC
low complexity region	1032	1052	N/A	INTRINSIC
low complexity region	1071	1087	N/A	INTRINSIC
low complexity region	1160	1218	N/A	INTRINSIC
low complexity region	1253	1265	N/A	INTRINSIC
internal_repeat_1	1273	1301	1.8e-6	PROSPERO
low complexity region	1325	1349	N/A	INTRINSIC
low complexity region	1366	1391	N/A	INTRINSIC
low complexity region	1400	1425	N/A	INTRINSIC
low complexity region	1431	1442	N/A	INTRINSIC
low complexity region	1690	1697	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000227049
AA Change: E976G

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.2%

Validation Efficiency

Allele List at MGI

All alleles(11) : Targeted, other(2) Gene trapped(9)

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600015I10Rik	T	C	6: 48,931,451	S462P	probably damaging	Het
Ablim1	A	T	19: 57,047,018	S316T	probably damaging	Het
Alox8	C	T	11: 69,186,288	V460I	probably damaging	Het
Arvcf	G	A	16: 18,399,732	A491T	probably damaging	Het
Asnsd1	A	G	1: 53,347,227	S414P	possibly damaging	Het
Btbd7	A	G	12: 102,790,709	L706P	probably damaging	Het
Camk2d	T	A	3: 126,780,456	W171R	probably damaging	Het
Casc3	T	A	11: 98,821,506	S124T	probably benign	Het
Casp8ap2	T	C	4: 32,644,560	V1211A	probably benign	Het
Ccdc182	T	C	11: 88,294,136	V14A	possibly damaging	Het
Ccdc80	A	T	16: 45,122,912	Q795L	probably damaging	Het
Ccdc88a	T	G	11: 29,503,480	S1614R	probably damaging	Het
Clcn6	A	G	4: 148,010,652		probably null	Het
Cubn	A	G	2: 13,308,549	V3070A	probably benign	Het
Dst	G	A	1: 34,166,291	V1025I	possibly damaging	Het
Dusp27	A	T	1: 166,100,823	W407R	probably benign	Het
Elk3	T	A	10: 93,265,677	I71F	probably damaging	Het
Flt3	A	T	5: 147,369,490	I276N	probably damaging	Het
Frem1	G	T	4: 82,913,558	T1988K	probably benign	Het
Gm597	A	T	1: 28,778,153	V266D	probably damaging	Het
Golph3l	T	A	3: 95,617,357	D306E	probably benign	Het
Grk2	T	A	19: 4,290,670	I254F	probably damaging	Het
Hgf	C	T	5: 16,576,921	T214I	probably benign	Het
Hoxc5	C	A	15: 103,014,382		probably null	Het
Hsd11b1	T	C	1: 193,240,378	T124A	probably benign	Het
Ipp	A	G	4: 116,515,368	Y198C	probably benign	Het
Ism1	T	A	2: 139,740,127		probably null	Het
Klhl42	A	G	6: 147,091,896	Y122C	possibly damaging	Het
Klk1b21	A	T	7: 44,105,994	K206*	probably null	Het
Lcn11	A	G	2: 25,778,085	K85R	probably benign	Het
Macf1	G	T	4: 123,472,730	A2746E	probably damaging	Het
Matn4	A	G	2: 164,400,653	V175A	probably damaging	Het
Myh2	A	T	11: 67,191,719	N1372Y	probably damaging	Het
Ncl	A	G	1: 86,356,955		probably null	Het
Nudt2	A	G	4: 41,480,255	D46G	probably damaging	Het
Obscn	C	T	11: 59,067,174	D3567N	probably benign	Het
Olfr1245	A	T	2: 89,574,961	M255K	possibly damaging	Het
Olfr346	G	C	2: 36,688,475	V158L	probably benign	Het
Olfr373	G	T	8: 72,100,086	V109F	possibly damaging	Het
Pamr1	T	A	2: 102,634,535	M343K	probably benign	Het
Pcdh15	T	G	10: 74,631,193	S1684A	possibly damaging	Het
Ppm1h	T	A	10: 122,878,528	L324*	probably null	Het
Ppp3r2	T	C	4: 49,681,723	I76V	probably benign	Het
Prkdc	G	A	16: 15,677,009	V748I	probably benign	Het
Prss47	A	G	13: 65,051,777	V96A	probably benign	Het
Rsbn1	C	T	3: 103,914,473	T8I	probably benign	Het
Rsf1	GGCG	GGCGACGGCGGCG	7: 97,579,906		probably benign	Het
Serpinb3d	A	G	1: 107,078,452	V302A	probably benign	Het
Sfrp4	A	T	13: 19,632,326	I177F	probably benign	Het
Sh3bp2	A	G	5: 34,544,225		probably benign	Het
Slc7a12	A	G	3: 14,497,333	T257A	probably damaging	Het
Specc1l	T	C	10: 75,267,591		probably null	Het
Stard9	A	G	2: 120,704,235	T3658A	probably benign	Het
Tctex1d4	A	G	4: 117,128,307	E109G	possibly damaging	Het
Tmem2	G	A	19: 21,844,750	A1170T	possibly damaging	Het
Tmem30c	T	C	16: 57,281,362	T68A	probably damaging	Het
Tnr	A	G	1: 159,852,022	I189V	probably benign	Het
Trrap	A	G	5: 144,853,488	N3586S	possibly damaging	Het
Usp14	T	C	18: 10,024,632	T22A	probably damaging	Het
Vmn1r68	A	G	7: 10,527,991	L60P	probably damaging	Het
Vmn2r108	G	A	17: 20,470,990	H424Y	probably benign	Het
Wdr81	C	A	11: 75,445,962	E1534*	probably null	Het
Zfp128	T	C	7: 12,890,029	L108P	possibly damaging	Het
Zfp644	T	C	5: 106,635,682	I1000V	possibly damaging	Het

Other mutations in Zc3h13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00945:Zc3h13	APN	14	75330147	missense	probably damaging	0.99
IGL01129:Zc3h13	APN	14	75335999	missense	probably damaging	1.00
IGL01599:Zc3h13	APN	14	75309723	missense	probably damaging	1.00
IGL01844:Zc3h13	APN	14	75343769	utr 3 prime	probably benign
IGL02132:Zc3h13	APN	14	75330347	missense	probably benign	0.10
IGL03108:Zc3h13	APN	14	75331766	missense	possibly damaging	0.73
IGL03299:Zc3h13	APN	14	75293941	missense	probably damaging	1.00
IGL03377:Zc3h13	APN	14	75293976	missense	possibly damaging	0.53
B5639:Zc3h13	UTSW	14	75316039	missense	probably damaging	1.00
FR4304:Zc3h13	UTSW	14	75323603	small insertion	probably benign
FR4304:Zc3h13	UTSW	14	75323610	small insertion	probably benign
FR4340:Zc3h13	UTSW	14	75323592	small insertion	probably benign
FR4449:Zc3h13	UTSW	14	75323601	nonsense	probably null
FR4548:Zc3h13	UTSW	14	75323599	small insertion	probably benign
FR4589:Zc3h13	UTSW	14	75323592	small insertion	probably benign
FR4589:Zc3h13	UTSW	14	75323597	small insertion	probably benign
FR4589:Zc3h13	UTSW	14	75323598	small insertion	probably benign
FR4737:Zc3h13	UTSW	14	75323596	small insertion	probably benign
FR4737:Zc3h13	UTSW	14	75323599	small insertion	probably benign
PIT4696001:Zc3h13	UTSW	14	75331883	missense	probably damaging	1.00
R0103:Zc3h13	UTSW	14	75330468	missense	probably damaging	0.98
R0103:Zc3h13	UTSW	14	75330468	missense	probably damaging	0.98
R0127:Zc3h13	UTSW	14	75323254	missense	unknown
R0374:Zc3h13	UTSW	14	75308965	missense	probably damaging	1.00
R0396:Zc3h13	UTSW	14	75323482	missense	unknown
R0408:Zc3h13	UTSW	14	75292186	nonsense	probably null
R0967:Zc3h13	UTSW	14	75343739	missense	possibly damaging	0.54
R1006:Zc3h13	UTSW	14	75330549	missense	probably damaging	0.99
R1142:Zc3h13	UTSW	14	75315984	missense	probably benign	0.14
R1605:Zc3h13	UTSW	14	75337483	nonsense	probably null
R2270:Zc3h13	UTSW	14	75332147	missense	probably benign	0.03
R3508:Zc3h13	UTSW	14	75308940	nonsense	probably null
R3745:Zc3h13	UTSW	14	75330661	missense	probably benign	0.03
R3954:Zc3h13	UTSW	14	75329738	missense	possibly damaging	0.85
R4205:Zc3h13	UTSW	14	75327601	missense	unknown
R4799:Zc3h13	UTSW	14	75339423	missense	probably damaging	1.00
R5042:Zc3h13	UTSW	14	75339396	missense	probably damaging	0.98
R5133:Zc3h13	UTSW	14	75336009	missense	probably damaging	1.00
R5384:Zc3h13	UTSW	14	75343619	missense	probably benign	0.14
R5432:Zc3h13	UTSW	14	75331247	missense	probably damaging	1.00
R5611:Zc3h13	UTSW	14	75330908	missense	probably benign	0.10
R5687:Zc3h13	UTSW	14	75331960	nonsense	probably null
R5726:Zc3h13	UTSW	14	75330829	missense	possibly damaging	0.84
R5817:Zc3h13	UTSW	14	75328132	missense	probably damaging	0.96
R6087:Zc3h13	UTSW	14	75330709	missense	probably damaging	0.96
R6224:Zc3h13	UTSW	14	75337409	missense	probably damaging	0.99
R6247:Zc3h13	UTSW	14	75343736	missense	probably benign	0.14
R6278:Zc3h13	UTSW	14	75330423	missense	probably benign	0.01
R6315:Zc3h13	UTSW	14	75308915	missense	probably damaging	1.00
R6490:Zc3h13	UTSW	14	75323558	small deletion	probably benign
R6598:Zc3h13	UTSW	14	75332183	missense	probably damaging	0.99
R7051:Zc3h13	UTSW	14	75331157	missense	probably damaging	1.00
R7054:Zc3h13	UTSW	14	75321787	missense	probably benign	0.19
R7135:Zc3h13	UTSW	14	75321721	missense	unknown
R7307:Zc3h13	UTSW	14	75330541	missense	probably damaging	0.96
R7515:Zc3h13	UTSW	14	75308909	missense	unknown
R7680:Zc3h13	UTSW	14	75330515	missense	probably damaging	0.99
R8031:Zc3h13	UTSW	14	75330630	missense	not run
R8048:Zc3h13	UTSW	14	75324537	missense	unknown
R8059:Zc3h13	UTSW	14	75327810	missense	unknown
R8362:Zc3h13	UTSW	14	75324469	missense	unknown
R8391:Zc3h13	UTSW	14	75331185	missense	probably damaging	1.00
R8724:Zc3h13	UTSW	14	75332072	missense	probably benign	0.05
R9081:Zc3h13	UTSW	14	75331941	small deletion	probably benign
R9082:Zc3h13	UTSW	14	75331941	small deletion	probably benign
R9101:Zc3h13	UTSW	14	75323602	missense	unknown
R9214:Zc3h13	UTSW	14	75323551	missense	unknown
R9308:Zc3h13	UTSW	14	75327978	missense	unknown
R9376:Zc3h13	UTSW	14	75323688	missense	unknown
R9618:Zc3h13	UTSW	14	75330102	missense
R9665:Zc3h13	UTSW	14	75330549	missense	probably damaging	0.99
Z1177:Zc3h13	UTSW	14	75328065	missense	unknown

Predicted Primers

PCR Primer
(F):5'- GGCCACTATCTTTCCTAGTATTGG -3'
(R):5'- TCATCATGGGCTCGATCAGAC -3'

Sequencing Primer
(F):5'- TGCCATTTTGAATCGAAAATTGAG -3'
(R):5'- TCGATCAGACCCGTCACG -3'

Posted On

2014-08-25