Incidental Mutation 'R2021:Hoxc5'
ID224033
Institutional Source Beutler Lab
Gene Symbol Hoxc5
Ensembl Gene ENSMUSG00000022485
Gene Namehomeobox C5
SynonymsHox-3.4, Hox-6.2
MMRRC Submission 040030-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.532) question?
Stock #R2021 (G1)
Quality Score192
Status Not validated
Chromosome15
Chromosomal Location102967443-103017429 bp(+) (GRCm38)
Type of Mutationsplice site (2501 bp from exon)
DNA Base Change (assembly) C to A at 103014382 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000001711 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001709] [ENSMUST00000001711] [ENSMUST00000165375]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001709
AA Change: Q101K

PolyPhen 2 Score 0.548 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000001709
Gene: ENSMUSG00000022485
AA Change: Q101K

DomainStartEndE-ValueType
low complexity region 69 85 N/A INTRINSIC
HOX 155 217 3.03e-26 SMART
Predicted Effect probably null
Transcript: ENSMUST00000001711
SMART Domains Protein: ENSMUSP00000001711
Gene: ENSMUSG00000001661

DomainStartEndE-ValueType
HOX 141 203 2.39e-24 SMART
low complexity region 221 235 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102056
Predicted Effect probably benign
Transcript: ENSMUST00000165375
SMART Domains Protein: ENSMUSP00000133561
Gene: ENSMUSG00000075394

DomainStartEndE-ValueType
low complexity region 46 68 N/A INTRINSIC
low complexity region 80 91 N/A INTRINSIC
low complexity region 100 122 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173210
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173421
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174869
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, which are located on different chromosomes and consist of 9 to 11 genes arranged in tandem. This gene, HOXC5, is one of several homeobox HOXC genes located in a cluster on chromosome 12. Three genes, HOXC5, HOXC4 and HOXC6, share a 5' non-coding exon. Transcripts may include the shared exon spliced to the gene-specific exons, or they may include only the gene-specific exons. Two alternatively spliced variants have been described for HOXC5. The transcript variant which includes the shared exon apparently doesn't encode a protein. The protein-coding transcript variant contains gene-specific exons only. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T C 6: 48,931,451 S462P probably damaging Het
Ablim1 A T 19: 57,047,018 S316T probably damaging Het
Alox8 C T 11: 69,186,288 V460I probably damaging Het
Arvcf G A 16: 18,399,732 A491T probably damaging Het
Asnsd1 A G 1: 53,347,227 S414P possibly damaging Het
Btbd7 A G 12: 102,790,709 L706P probably damaging Het
Camk2d T A 3: 126,780,456 W171R probably damaging Het
Casc3 T A 11: 98,821,506 S124T probably benign Het
Casp8ap2 T C 4: 32,644,560 V1211A probably benign Het
Ccdc182 T C 11: 88,294,136 V14A possibly damaging Het
Ccdc80 A T 16: 45,122,912 Q795L probably damaging Het
Ccdc88a T G 11: 29,503,480 S1614R probably damaging Het
Clcn6 A G 4: 148,010,652 probably null Het
Cubn A G 2: 13,308,549 V3070A probably benign Het
Dst G A 1: 34,166,291 V1025I possibly damaging Het
Dusp27 A T 1: 166,100,823 W407R probably benign Het
Elk3 T A 10: 93,265,677 I71F probably damaging Het
Flt3 A T 5: 147,369,490 I276N probably damaging Het
Frem1 G T 4: 82,913,558 T1988K probably benign Het
Gm597 A T 1: 28,778,153 V266D probably damaging Het
Golph3l T A 3: 95,617,357 D306E probably benign Het
Grk2 T A 19: 4,290,670 I254F probably damaging Het
Hgf C T 5: 16,576,921 T214I probably benign Het
Hsd11b1 T C 1: 193,240,378 T124A probably benign Het
Ipp A G 4: 116,515,368 Y198C probably benign Het
Ism1 T A 2: 139,740,127 probably null Het
Klhl42 A G 6: 147,091,896 Y122C possibly damaging Het
Klk1b21 A T 7: 44,105,994 K206* probably null Het
Lcn11 A G 2: 25,778,085 K85R probably benign Het
Macf1 G T 4: 123,472,730 A2746E probably damaging Het
Matn4 A G 2: 164,400,653 V175A probably damaging Het
Myh2 A T 11: 67,191,719 N1372Y probably damaging Het
Ncl A G 1: 86,356,955 probably null Het
Nudt2 A G 4: 41,480,255 D46G probably damaging Het
Obscn C T 11: 59,067,174 D3567N probably benign Het
Olfr1245 A T 2: 89,574,961 M255K possibly damaging Het
Olfr346 G C 2: 36,688,475 V158L probably benign Het
Olfr373 G T 8: 72,100,086 V109F possibly damaging Het
Pamr1 T A 2: 102,634,535 M343K probably benign Het
Pcdh15 T G 10: 74,631,193 S1684A possibly damaging Het
Ppm1h T A 10: 122,878,528 L324* probably null Het
Ppp3r2 T C 4: 49,681,723 I76V probably benign Het
Prkdc G A 16: 15,677,009 V748I probably benign Het
Prss47 A G 13: 65,051,777 V96A probably benign Het
Rsbn1 C T 3: 103,914,473 T8I probably benign Het
Rsf1 GGCG GGCGACGGCGGCG 7: 97,579,906 probably benign Het
Serpinb3d A G 1: 107,078,452 V302A probably benign Het
Sfrp4 A T 13: 19,632,326 I177F probably benign Het
Sh3bp2 A G 5: 34,544,225 probably benign Het
Slc7a12 A G 3: 14,497,333 T257A probably damaging Het
Specc1l T C 10: 75,267,591 probably null Het
Stard9 A G 2: 120,704,235 T3658A probably benign Het
Tctex1d4 A G 4: 117,128,307 E109G possibly damaging Het
Tmem2 G A 19: 21,844,750 A1170T possibly damaging Het
Tmem30c T C 16: 57,281,362 T68A probably damaging Het
Tnr A G 1: 159,852,022 I189V probably benign Het
Trrap A G 5: 144,853,488 N3586S possibly damaging Het
Usp14 T C 18: 10,024,632 T22A probably damaging Het
Vmn1r68 A G 7: 10,527,991 L60P probably damaging Het
Vmn2r108 G A 17: 20,470,990 H424Y probably benign Het
Wdr81 C A 11: 75,445,962 E1534* probably null Het
Zc3h13 A G 14: 75,330,195 E976G probably damaging Het
Zfp128 T C 7: 12,890,029 L108P possibly damaging Het
Zfp644 T C 5: 106,635,682 I1000V possibly damaging Het
Other mutations in Hoxc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03339:Hoxc5 APN 15 103014136 missense probably damaging 0.98
R0386:Hoxc5 UTSW 15 103015352 nonsense probably null
R1797:Hoxc5 UTSW 15 103014434 missense probably benign 0.00
R4851:Hoxc5 UTSW 15 103015369 missense probably damaging 1.00
R4967:Hoxc5 UTSW 15 103015354 missense probably damaging 1.00
R5089:Hoxc5 UTSW 15 103014055 unclassified probably benign
R6718:Hoxc5 UTSW 15 103014266 splice site probably null
R6784:Hoxc5 UTSW 15 103013890 unclassified probably benign
R6927:Hoxc5 UTSW 15 103015375 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTGTGGGAACTATGGATCG -3'
(R):5'- AGTCCTAAAGTTTACCGTGGC -3'

Sequencing Primer
(F):5'- CTACGGCGGATTGGACTTAAGC -3'
(R):5'- CTAAAGTTTACCGTGGCTCATG -3'
Posted On2014-08-25