Incidental Mutation 'R1993:Eif3a'
ID224044
Institutional Source Beutler Lab
Gene Symbol Eif3a
Ensembl Gene ENSMUSG00000024991
Gene Nameeukaryotic translation initiation factor 3, subunit A
SynonymsEif3s10, A830012B05Rik, Eif3, Csma
MMRRC Submission 040004-MU
Accession Numbers

Genbank: NM_010123

Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R1993 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location60761116-60790693 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 60781516 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 127 (V127I)
Ref Sequence ENSEMBL: ENSMUSP00000025955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025955]
Predicted Effect probably benign
Transcript: ENSMUST00000025955
AA Change: V127I

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000025955
Gene: ENSMUSG00000024991
AA Change: V127I

DomainStartEndE-ValueType
coiled coil region 82 120 N/A INTRINSIC
PINT 426 506 5.69e-18 SMART
SCOP:d1f5aa2 563 711 5e-3 SMART
coiled coil region 772 880 N/A INTRINSIC
low complexity region 919 947 N/A INTRINSIC
low complexity region 951 976 N/A INTRINSIC
internal_repeat_2 978 991 1.01e-8 PROSPERO
low complexity region 993 1007 N/A INTRINSIC
low complexity region 1013 1027 N/A INTRINSIC
low complexity region 1033 1057 N/A INTRINSIC
low complexity region 1064 1089 N/A INTRINSIC
internal_repeat_1 1090 1111 6.2e-12 PROSPERO
internal_repeat_2 1099 1112 1.01e-8 PROSPERO
internal_repeat_1 1110 1131 6.2e-12 PROSPERO
low complexity region 1146 1173 N/A INTRINSIC
low complexity region 1176 1206 N/A INTRINSIC
low complexity region 1221 1260 N/A INTRINSIC
low complexity region 1265 1297 N/A INTRINSIC
low complexity region 1301 1314 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI

All alleles(36) : Targeted, other(2) Gene trapped(34)

Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T G 5: 8,821,322 I292S possibly damaging Het
Abcc4 T C 14: 118,526,282 N1047S probably benign Het
Abcc8 G T 7: 46,117,423 probably null Het
Akap9 T A 5: 4,038,520 probably null Het
Alox5 T A 6: 116,415,463 I366F probably damaging Het
Amn A G 12: 111,276,092 N447S probably damaging Het
Ankrd22 A T 19: 34,165,774 M1K probably null Het
Asic1 G T 15: 99,671,884 G29C probably damaging Het
Atxn7l1 A G 12: 33,345,977 N235S probably benign Het
AY358078 T A 14: 51,826,062 D388E probably damaging Het
Bod1l A G 5: 41,817,336 S2212P probably damaging Het
Cacna1e T A 1: 154,477,817 Q423L probably damaging Het
Calu T C 6: 29,366,975 I62T possibly damaging Het
Cars2 A G 8: 11,514,515 V75A probably benign Het
Catsperb T A 12: 101,602,767 N899K possibly damaging Het
Ccdc50 T A 16: 27,409,339 C86* probably null Het
Cdh5 G T 8: 104,137,815 L469F probably damaging Het
Clrn3 A T 7: 135,514,119 D167E probably benign Het
Csmd1 A T 8: 16,346,684 C411S probably damaging Het
Dchs1 A T 7: 105,762,548 S1454T probably benign Het
Ddx20 G A 3: 105,679,344 Q562* probably null Het
Dgkg T G 16: 22,600,594 Y52S probably damaging Het
Dhx58 T C 11: 100,703,490 probably null Het
Dpp6 A T 5: 27,399,006 I145L probably benign Het
Efna2 A T 10: 80,186,877 Y85F possibly damaging Het
Exph5 A T 9: 53,373,635 H672L possibly damaging Het
Fam131b T C 6: 42,320,884 T112A possibly damaging Het
Fam71e2 A T 7: 4,758,018 V565E probably damaging Het
Fcgr1 A T 3: 96,285,868 V271E probably damaging Het
Fgfr4 A G 13: 55,165,902 D508G probably damaging Het
Fndc3b A G 3: 27,419,400 M1172T probably benign Het
Fryl G T 5: 73,108,493 T495K probably damaging Het
Gm5134 A T 10: 75,966,393 I93F probably damaging Het
Gpbar1 G A 1: 74,279,444 G282D possibly damaging Het
Gria2 G A 3: 80,802,357 L10F probably benign Het
Grm7 T C 6: 111,207,808 Y367H probably benign Het
Hils1 T A 11: 94,968,032 V51E probably damaging Het
Hivep1 G A 13: 42,157,493 A1070T probably benign Het
Il33 A G 19: 29,956,904 D155G possibly damaging Het
Kdm6b T C 11: 69,406,303 S408G probably null Het
Kntc1 G A 5: 123,759,099 probably null Het
Kntc1 A G 5: 123,810,811 probably null Het
Ltbp2 T G 12: 84,808,446 probably null Het
Mapk8ip3 G T 17: 24,914,588 L83I probably damaging Het
Meltf C A 16: 31,892,622 Y554* probably null Het
Mov10 A C 3: 104,799,419 F725C probably damaging Het
Ms4a6d A C 19: 11,590,159 L18R probably damaging Het
Naip2 T C 13: 100,162,007 N507S probably benign Het
Nodal A G 10: 61,418,334 Q12R probably benign Het
Npy6r T C 18: 44,276,508 L332P probably damaging Het
Nrxn3 A G 12: 89,260,411 K272R possibly damaging Het
Obox2 G T 7: 15,397,249 K93N probably benign Het
Olfr1136 C T 2: 87,693,433 V150M probably benign Het
Olfr1408 C T 1: 173,130,851 R122H possibly damaging Het
Olfr1466 A G 19: 13,341,814 T19A possibly damaging Het
Olfr575 G T 7: 102,954,746 P285Q probably damaging Het
Pcdh12 T A 18: 38,282,143 D643V possibly damaging Het
Pcsk2 A G 2: 143,687,619 D112G probably benign Het
Pms1 A G 1: 53,195,015 S781P probably benign Het
Prtg A G 9: 72,844,896 D188G probably benign Het
Psg21 A T 7: 18,654,770 N132K probably benign Het
Psip1 A G 4: 83,482,532 V25A probably damaging Het
Psmd13 T A 7: 140,898,194 I319N probably damaging Het
Ptges2 A G 2: 32,400,092 T173A probably benign Het
Ptprm G A 17: 66,747,160 R975W probably damaging Het
Rdh1 A G 10: 127,765,345 D254G probably benign Het
Rnf138 T G 18: 21,024,483 N212K probably damaging Het
Serpine2 A G 1: 79,821,442 S32P probably damaging Het
Serpini1 G T 3: 75,614,664 W154L probably damaging Het
Sf3a1 C A 11: 4,179,177 Q713K possibly damaging Het
Sgo2b A T 8: 63,926,833 H988Q probably benign Het
Sin3a T C 9: 57,101,199 F468L probably damaging Het
Slamf6 A T 1: 171,934,209 I66F possibly damaging Het
Slc22a28 A T 19: 8,117,124 C178S possibly damaging Het
Slc35a1 A C 4: 34,675,181 V119G probably damaging Het
Slc39a12 A T 2: 14,434,219 H428L probably damaging Het
Speer2 A G 16: 69,858,077 S167P probably benign Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Spsb2 T C 6: 124,809,366 probably null Het
Stam2 A T 2: 52,703,156 Y341* probably null Het
Sv2b G A 7: 75,206,341 A67V probably benign Het
Svep1 A G 4: 58,064,170 probably null Het
Syt15 A T 14: 34,223,012 Q172L probably benign Het
T G A 17: 8,441,802 S415N probably benign Het
Tep1 A G 14: 50,824,184 F2625S possibly damaging Het
Tex14 T C 11: 87,536,755 V11A possibly damaging Het
Tiam2 A T 17: 3,415,126 R377* probably null Het
Tirap A G 9: 35,191,016 probably null Het
Tm4sf20 T C 1: 82,760,217 T118A probably benign Het
Trank1 A T 9: 111,378,832 Q1715L probably benign Het
Trpm2 C T 10: 77,947,989 V217M probably damaging Het
Ubap1l G A 9: 65,371,796 E126K possibly damaging Het
Urgcp G T 11: 5,716,526 P604Q probably damaging Het
Vmn1r63 A G 7: 5,803,255 V126A probably benign Het
Vmn2r90 T C 17: 17,713,263 C362R probably damaging Het
Vmn2r96 A G 17: 18,583,876 I271V probably damaging Het
Vps13a A T 19: 16,722,458 I740K probably benign Het
Vps13c A G 9: 67,975,856 T3562A probably damaging Het
Wdr91 T A 6: 34,892,362 H409L probably damaging Het
Wnt7a T A 6: 91,365,956 T315S possibly damaging Het
Zfp616 A G 11: 74,084,969 H688R probably benign Het
Zfp763 A T 17: 33,018,439 H577Q probably damaging Het
Zfp808 G A 13: 62,172,907 S650N probably benign Het
Zfp977 A T 7: 42,579,985 M372K probably benign Het
Other mutations in Eif3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Eif3a APN 19 60769890 missense unknown
IGL00981:Eif3a APN 19 60766611 missense unknown
IGL01650:Eif3a APN 19 60773996 missense probably damaging 1.00
IGL01926:Eif3a APN 19 60769961 missense unknown
IGL02100:Eif3a APN 19 60767004 splice site probably benign
IGL02316:Eif3a APN 19 60771638 splice site probably benign
IGL02444:Eif3a APN 19 60773607 missense possibly damaging 0.89
IGL02552:Eif3a APN 19 60763226 unclassified probably benign
IGL02797:Eif3a APN 19 60772726 missense probably damaging 1.00
IGL03108:Eif3a APN 19 60782309 missense possibly damaging 0.85
FR4304:Eif3a UTSW 19 60775290 critical splice donor site probably benign
FR4548:Eif3a UTSW 19 60775291 critical splice donor site probably benign
FR4737:Eif3a UTSW 19 60775289 critical splice donor site probably benign
FR4976:Eif3a UTSW 19 60775291 critical splice donor site probably benign
G5538:Eif3a UTSW 19 60781902 missense probably damaging 0.97
R0054:Eif3a UTSW 19 60766826 missense unknown
R0054:Eif3a UTSW 19 60766826 missense unknown
R1483:Eif3a UTSW 19 60768726 missense unknown
R1636:Eif3a UTSW 19 60781905 missense possibly damaging 0.93
R1748:Eif3a UTSW 19 60766798 missense unknown
R1857:Eif3a UTSW 19 60782197 missense probably damaging 1.00
R1858:Eif3a UTSW 19 60782197 missense probably damaging 1.00
R2034:Eif3a UTSW 19 60762130 unclassified probably benign
R2099:Eif3a UTSW 19 60764113 unclassified probably benign
R2140:Eif3a UTSW 19 60775394 splice site probably benign
R2434:Eif3a UTSW 19 60764050 unclassified probably benign
R2940:Eif3a UTSW 19 60773677 missense probably benign 0.22
R4630:Eif3a UTSW 19 60769928 missense unknown
R4630:Eif3a UTSW 19 60777986 missense probably benign 0.41
R4926:Eif3a UTSW 19 60763218 unclassified probably benign
R5366:Eif3a UTSW 19 60779533 missense probably benign 0.12
R6003:Eif3a UTSW 19 60766881 missense unknown
R6082:Eif3a UTSW 19 60772130 missense possibly damaging 0.82
R6256:Eif3a UTSW 19 60771026 missense possibly damaging 0.72
R7056:Eif3a UTSW 19 60763062 splice site probably null
R7365:Eif3a UTSW 19 60766644 missense unknown
X0028:Eif3a UTSW 19 60781902 missense probably damaging 0.97
X0066:Eif3a UTSW 19 60762293 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CATTTTACCTTGTTGGGCGATATC -3'
(R):5'- ATGTACTTCAGGAACCATGTAAGC -3'

Sequencing Primer
(F):5'- TCATGGTAAAGGCGCTCTAC -3'
(R):5'- ATTCCTTGGAGTGGAACATGC -3'
Posted On2014-08-25