Incidental Mutation 'R1994:Mgat5'
ID 224057
Institutional Source Beutler Lab
Gene Symbol Mgat5
Ensembl Gene ENSMUSG00000036155
Gene Name mannoside acetylglucosaminyltransferase 5
Synonyms 4930471A21Rik, 5330407H02Rik, GlcNAc-TV, beta1,6N-acetylglucosaminyltransferase V
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1994 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 127132450-127413760 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 127387696 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 551 (I551F)
Ref Sequence ENSEMBL: ENSMUSP00000129166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038361] [ENSMUST00000171405]
AlphaFold Q8R4G6
Predicted Effect possibly damaging
Transcript: ENSMUST00000038361
AA Change: I551F

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000038359
Gene: ENSMUSG00000036155
AA Change: I551F

DomainStartEndE-ValueType
Pfam:DUF4525 2 138 3.4e-70 PFAM
Pfam:Glyco_transf_18 171 725 9.8e-268 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000171405
AA Change: I551F

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000129166
Gene: ENSMUSG00000036155
AA Change: I551F

DomainStartEndE-ValueType
Pfam:DUF4525 3 137 9.3e-64 PFAM
Pfam:Glyco_transf_18 171 725 1.9e-268 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the glycosyltransferase family. It catalyzes the addition of beta-1,6-N-acetylglucosamine to the alpha-linked mannose of biantennary N-linked oligosaccharides present on the newly synthesized glycoproteins. It is one of the most important enzymes involved in the regulation of the biosynthesis of glycoprotein oligosaccharides. Alterations of the oligosaccharides on cell surface glycoproteins cause significant changes in the adhesive or migratory behavior of a cell. Increase in the activity of this enzyme has been correlated with the progression of invasive malignancies. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for deficiencies in this gene have immune system abnormalities and reduced cancer growth and metastasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,113,014 (GRCm39) probably null Het
Abcc8 T G 7: 45,806,543 (GRCm39) R388S probably benign Het
Abhd18 C T 3: 40,889,361 (GRCm39) R414* probably null Het
Acap1 C T 11: 69,780,324 (GRCm39) V40I probably benign Het
Actn1 C A 12: 80,251,745 (GRCm39) G111* probably null Het
Adam26b T C 8: 43,973,676 (GRCm39) Q442R probably benign Het
Adamts19 T C 18: 59,105,903 (GRCm39) probably null Het
Agtpbp1 T G 13: 59,678,872 (GRCm39) K145N probably damaging Het
AI661453 A G 17: 47,777,959 (GRCm39) probably benign Het
Ap4e1 T C 2: 126,903,467 (GRCm39) S790P probably benign Het
Asmt A G X: 169,109,524 (GRCm39) E168G possibly damaging Het
Atp2a3 T A 11: 72,866,240 (GRCm39) S287T probably damaging Het
AY358078 T A 14: 52,063,519 (GRCm39) D388E probably damaging Het
Bicd1 A T 6: 149,415,050 (GRCm39) T588S probably benign Het
Birc6 T G 17: 74,905,057 (GRCm39) N1283K probably benign Het
Cacna1e T A 1: 154,353,563 (GRCm39) Q423L probably damaging Het
Capn3 T A 2: 120,326,418 (GRCm39) Y537N probably damaging Het
Ccn3 T A 15: 54,612,750 (GRCm39) V253E probably benign Het
Cep295 C T 9: 15,252,179 (GRCm39) E397K probably damaging Het
Chgb T C 2: 132,628,418 (GRCm39) S48P possibly damaging Het
Cidec T A 6: 113,405,193 (GRCm39) Y159F probably damaging Het
Clec18a T C 8: 111,808,234 (GRCm39) S66G possibly damaging Het
Cpsf1 G A 15: 76,487,360 (GRCm39) T138M probably benign Het
Dclre1c C T 2: 3,439,022 (GRCm39) R61W probably damaging Het
Eef1akmt1 A C 14: 57,787,911 (GRCm39) V149G probably benign Het
Fam131b T C 6: 42,297,818 (GRCm39) T112A possibly damaging Het
Fbln2 A G 6: 91,211,283 (GRCm39) E409G probably damaging Het
Fkbp15 G A 4: 62,222,618 (GRCm39) P1094S probably benign Het
Fpr1 A G 17: 18,097,879 (GRCm39) S37P probably benign Het
Fryl G T 5: 73,265,836 (GRCm39) T495K probably damaging Het
Gja6 A T X: 159,686,374 (GRCm39) I186N possibly damaging Het
Gm4922 T C 10: 18,659,388 (GRCm39) T445A probably benign Het
Gria2 G A 3: 80,709,664 (GRCm39) L10F probably benign Het
Gspt2 A G X: 93,681,025 (GRCm39) D388G possibly damaging Het
Hdc T A 2: 126,458,107 (GRCm39) I72F probably damaging Het
Ift70b A G 2: 75,768,402 (GRCm39) L117P probably damaging Het
Igf2r T C 17: 12,911,625 (GRCm39) K1905E probably benign Het
Il33 A G 19: 29,934,304 (GRCm39) D155G possibly damaging Het
Klk1b9 C T 7: 43,628,979 (GRCm39) T161I probably benign Het
Mfsd12 C A 10: 81,193,515 (GRCm39) H28Q probably damaging Het
Miga2 A T 2: 30,272,000 (GRCm39) D25V probably damaging Het
Mlc1 T C 15: 88,858,782 (GRCm39) N122S possibly damaging Het
Mmp20 T A 9: 7,645,293 (GRCm39) M281K probably benign Het
Muc5ac C A 7: 141,366,889 (GRCm39) P2232T possibly damaging Het
N4bp2l2 A G 5: 150,584,748 (GRCm39) S411P possibly damaging Het
Ngef G A 1: 87,415,626 (GRCm39) S346L probably damaging Het
Or10j27 C T 1: 172,958,418 (GRCm39) R122H possibly damaging Het
Or2t6 A G 14: 14,175,854 (GRCm38) I76T probably benign Het
Or4c112 T A 2: 88,853,487 (GRCm39) T287S probably damaging Het
Or4f15 T A 2: 111,814,429 (GRCm39) M5L probably benign Het
Or51aa2 T C 7: 103,187,566 (GRCm39) I292V possibly damaging Het
Or52m2 C T 7: 102,263,747 (GRCm39) V150M probably damaging Het
Or56b2 T C 7: 104,337,690 (GRCm39) I156T probably benign Het
Or6c215 T C 10: 129,637,530 (GRCm39) Y288C probably damaging Het
Or6c6 T A 10: 129,186,561 (GRCm39) I43N probably damaging Het
Pecam1 G T 11: 106,586,763 (GRCm39) H150N possibly damaging Het
Polr3c A T 3: 96,621,689 (GRCm39) probably null Het
Pop1 A C 15: 34,530,617 (GRCm39) Q1005P probably damaging Het
Prss22 G A 17: 24,215,288 (GRCm39) P163S probably damaging Het
Prss33 G A 17: 24,053,172 (GRCm39) A223V probably damaging Het
Prss53 C T 7: 127,486,565 (GRCm39) V354I probably benign Het
Rab3gap2 C T 1: 184,968,221 (GRCm39) T191I probably damaging Het
Rictor T C 15: 6,805,637 (GRCm39) F608L probably benign Het
Ryr3 T A 2: 112,484,837 (GRCm39) E3884V probably null Het
Scaf11 G A 15: 96,316,721 (GRCm39) R948* probably null Het
Sec61g A T 11: 16,456,444 (GRCm39) V40E probably damaging Het
Serpinb3d A T 1: 107,008,518 (GRCm39) F116I possibly damaging Het
Sipa1l3 T C 7: 29,099,036 (GRCm39) D411G probably benign Het
Slc13a3 T C 2: 165,275,984 (GRCm39) N254S possibly damaging Het
Slc35a2 T A X: 7,759,064 (GRCm39) L110Q probably damaging Het
Spata31d1b G C 13: 59,864,194 (GRCm39) L447F probably benign Het
Spsb2 T C 6: 124,786,329 (GRCm39) probably null Het
Tent4b C T 8: 88,973,112 (GRCm39) T277M probably damaging Het
Tmcc3 T C 10: 94,414,468 (GRCm39) S57P possibly damaging Het
Traf7 A G 17: 24,729,476 (GRCm39) V445A probably damaging Het
Trib1 A G 15: 59,521,192 (GRCm39) S61G possibly damaging Het
Trip12 A T 1: 84,726,893 (GRCm39) F36I probably damaging Het
Tshz3 T C 7: 36,469,247 (GRCm39) I412T probably damaging Het
Tsku T C 7: 98,001,353 (GRCm39) Y326C probably damaging Het
Ttn T G 2: 76,712,038 (GRCm39) probably benign Het
Ugt1a6a G A 1: 88,066,470 (GRCm39) R92H probably benign Het
Vmn1r63 A G 7: 5,806,254 (GRCm39) V126A probably benign Het
Vmn2r84 T A 10: 130,221,878 (GRCm39) S781C probably damaging Het
Wdr91 T A 6: 34,869,297 (GRCm39) H409L probably damaging Het
Wnt7a T A 6: 91,342,938 (GRCm39) T315S possibly damaging Het
Zdhhc25 A G 15: 88,485,027 (GRCm39) T121A probably benign Het
Zfp109 T C 7: 23,928,743 (GRCm39) H222R probably benign Het
Zfp286 A G 11: 62,670,646 (GRCm39) S476P probably damaging Het
Zfp605 T C 5: 110,275,418 (GRCm39) Y179H probably damaging Het
Zfp955a T C 17: 33,460,620 (GRCm39) H504R probably damaging Het
Zswim2 T A 2: 83,746,007 (GRCm39) N477I possibly damaging Het
Other mutations in Mgat5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Mgat5 APN 1 127,315,204 (GRCm39) missense probably damaging 1.00
IGL00813:Mgat5 APN 1 127,312,543 (GRCm39) missense probably benign
IGL01795:Mgat5 APN 1 127,396,968 (GRCm39) missense probably damaging 0.98
IGL01830:Mgat5 APN 1 127,339,869 (GRCm39) missense probably damaging 1.00
IGL01879:Mgat5 APN 1 127,325,287 (GRCm39) missense probably damaging 0.99
IGL02322:Mgat5 APN 1 127,310,722 (GRCm39) missense probably benign 0.00
IGL02621:Mgat5 APN 1 127,325,326 (GRCm39) missense possibly damaging 0.86
IGL02695:Mgat5 APN 1 127,339,868 (GRCm39) missense probably damaging 1.00
IGL03142:Mgat5 APN 1 127,339,960 (GRCm39) missense probably damaging 1.00
Cowlick UTSW 1 127,399,301 (GRCm39) missense probably benign 0.36
Curls UTSW 1 127,248,371 (GRCm39) missense possibly damaging 0.77
R0518:Mgat5 UTSW 1 127,312,584 (GRCm39) missense probably damaging 1.00
R0594:Mgat5 UTSW 1 127,339,985 (GRCm39) missense probably damaging 0.96
R1480:Mgat5 UTSW 1 127,387,716 (GRCm39) missense probably damaging 1.00
R1501:Mgat5 UTSW 1 127,325,378 (GRCm39) critical splice donor site probably null
R1712:Mgat5 UTSW 1 127,248,375 (GRCm39) missense probably benign 0.34
R1744:Mgat5 UTSW 1 127,407,206 (GRCm39) missense probably damaging 1.00
R1862:Mgat5 UTSW 1 127,387,706 (GRCm39) missense probably damaging 1.00
R2054:Mgat5 UTSW 1 127,325,344 (GRCm39) missense probably damaging 1.00
R2150:Mgat5 UTSW 1 127,396,987 (GRCm39) missense probably damaging 1.00
R2303:Mgat5 UTSW 1 127,374,036 (GRCm39) missense probably benign 0.00
R2566:Mgat5 UTSW 1 127,234,741 (GRCm39) missense probably benign 0.01
R3498:Mgat5 UTSW 1 127,312,571 (GRCm39) missense possibly damaging 0.55
R3788:Mgat5 UTSW 1 127,294,180 (GRCm39) missense probably benign
R4674:Mgat5 UTSW 1 127,318,495 (GRCm39) missense probably damaging 1.00
R4873:Mgat5 UTSW 1 127,396,986 (GRCm39) missense probably damaging 1.00
R4875:Mgat5 UTSW 1 127,396,986 (GRCm39) missense probably damaging 1.00
R5175:Mgat5 UTSW 1 127,387,649 (GRCm39) missense probably damaging 0.97
R5310:Mgat5 UTSW 1 127,315,251 (GRCm39) critical splice donor site probably null
R5337:Mgat5 UTSW 1 127,387,658 (GRCm39) missense possibly damaging 0.84
R5597:Mgat5 UTSW 1 127,325,303 (GRCm39) missense probably damaging 1.00
R5599:Mgat5 UTSW 1 127,325,303 (GRCm39) missense probably damaging 1.00
R5861:Mgat5 UTSW 1 127,315,129 (GRCm39) missense probably damaging 1.00
R5956:Mgat5 UTSW 1 127,310,676 (GRCm39) missense probably benign 0.10
R6042:Mgat5 UTSW 1 127,387,636 (GRCm39) missense probably damaging 1.00
R6223:Mgat5 UTSW 1 127,310,716 (GRCm39) missense possibly damaging 0.86
R6492:Mgat5 UTSW 1 127,399,301 (GRCm39) missense probably benign 0.36
R6662:Mgat5 UTSW 1 127,396,974 (GRCm39) missense probably damaging 1.00
R6960:Mgat5 UTSW 1 127,248,371 (GRCm39) missense possibly damaging 0.77
R6981:Mgat5 UTSW 1 127,318,588 (GRCm39) missense probably damaging 0.98
R7110:Mgat5 UTSW 1 127,310,716 (GRCm39) missense possibly damaging 0.92
R7133:Mgat5 UTSW 1 127,292,926 (GRCm39) missense probably benign
R7142:Mgat5 UTSW 1 127,339,924 (GRCm39) missense probably damaging 1.00
R7151:Mgat5 UTSW 1 127,373,999 (GRCm39) missense probably damaging 0.97
R7506:Mgat5 UTSW 1 127,294,192 (GRCm39) missense probably benign 0.24
R7790:Mgat5 UTSW 1 127,339,941 (GRCm39) missense probably benign 0.23
R7980:Mgat5 UTSW 1 127,407,248 (GRCm39) missense probably benign 0.13
R8548:Mgat5 UTSW 1 127,248,409 (GRCm39) missense possibly damaging 0.77
R9008:Mgat5 UTSW 1 127,407,308 (GRCm39) missense probably damaging 1.00
R9127:Mgat5 UTSW 1 127,294,197 (GRCm39) missense probably benign 0.14
R9279:Mgat5 UTSW 1 127,325,348 (GRCm39) missense probably damaging 1.00
R9599:Mgat5 UTSW 1 127,248,445 (GRCm39) missense probably benign 0.02
X0028:Mgat5 UTSW 1 127,294,222 (GRCm39) missense possibly damaging 0.91
Z1177:Mgat5 UTSW 1 127,410,429 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGTCTGACTGGTATCTCCATG -3'
(R):5'- AACCTGTGTGGAACTCCTCC -3'

Sequencing Primer
(F):5'- ACTGGTATCTCCATGTGATGTC -3'
(R):5'- GTCAAATCAGTGAGCTCTGAGTTCAG -3'
Posted On 2014-08-25