Incidental Mutation 'R1994:Abcb11'
ID224071
Institutional Source Beutler Lab
Gene Symbol Abcb11
Ensembl Gene ENSMUSG00000027048
Gene NameATP-binding cassette, sub-family B (MDR/TAP), member 11
SynonymsPFIC2, Bsep, PGY4, Lith1, ABC16, sister of P-glycoprotein
Accession Numbers

Genbank: NM_021022; MGI: 1351619

Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock #R1994 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location69238282-69342616 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 69282670 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000137017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102709] [ENSMUST00000102709] [ENSMUST00000102710] [ENSMUST00000102710] [ENSMUST00000180142] [ENSMUST00000180142]
Predicted Effect probably null
Transcript: ENSMUST00000102709
SMART Domains Protein: ENSMUSP00000099770
Gene: ENSMUSG00000027048

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 373 1.3e-65 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1031 2.7e-55 PFAM
AAA 1105 1299 1.9e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000102709
SMART Domains Protein: ENSMUSP00000099770
Gene: ENSMUSG00000027048

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 373 1.3e-65 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1031 2.7e-55 PFAM
AAA 1105 1299 1.9e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000102710
SMART Domains Protein: ENSMUSP00000099771
Gene: ENSMUSG00000027048

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 371 1.7e-72 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1029 3.2e-59 PFAM
AAA 1105 1299 1.9e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000102710
SMART Domains Protein: ENSMUSP00000099771
Gene: ENSMUSG00000027048

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 371 1.7e-72 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1029 3.2e-59 PFAM
AAA 1105 1299 1.9e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000180142
SMART Domains Protein: ENSMUSP00000137017
Gene: ENSMUSG00000027048

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 371 1.4e-72 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1029 2.5e-59 PFAM
AAA 1105 1299 1.9e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000180142
SMART Domains Protein: ENSMUSP00000137017
Gene: ENSMUSG00000027048

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 371 1.4e-72 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1029 2.5e-59 PFAM
AAA 1105 1299 1.9e-17 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. The protein encoded by this gene is the major canalicular bile salt transporter in humans and mice. Mutations in the human gene cause a form of progressive familial intrahepatic cholestases which are a group of inherited disorders with severe cholestatic liver disease from early infancy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display intrahepatic cholestasis. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 T G 7: 46,157,119 R388S probably benign Het
Abhd18 C T 3: 40,934,926 R414* probably null Het
Acap1 C T 11: 69,889,498 V40I probably benign Het
Actn1 C A 12: 80,204,971 G111* probably null Het
Adam26b T C 8: 43,520,639 Q442R probably benign Het
Adamts19 T C 18: 58,972,831 probably null Het
Agtpbp1 T G 13: 59,531,058 K145N probably damaging Het
AI661453 A G 17: 47,467,034 probably benign Het
Ap4e1 T C 2: 127,061,547 S790P probably benign Het
Asmt A G X: 170,675,789 E168G possibly damaging Het
Atp2a3 T A 11: 72,975,414 S287T probably damaging Het
AY358078 T A 14: 51,826,062 D388E probably damaging Het
Bicd1 A T 6: 149,513,552 T588S probably benign Het
Birc6 T G 17: 74,598,062 N1283K probably benign Het
Cacna1e T A 1: 154,477,817 Q423L probably damaging Het
Capn3 T A 2: 120,495,937 Y537N probably damaging Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Chgb T C 2: 132,786,498 S48P possibly damaging Het
Cidec T A 6: 113,428,232 Y159F probably damaging Het
Clec18a T C 8: 111,081,602 S66G possibly damaging Het
Cpsf1 G A 15: 76,603,160 T138M probably benign Het
Dclre1c C T 2: 3,437,985 R61W probably damaging Het
Eef1akmt1 A C 14: 57,550,454 V149G probably benign Het
Fam131b T C 6: 42,320,884 T112A possibly damaging Het
Fbln2 A G 6: 91,234,301 E409G probably damaging Het
Fkbp15 G A 4: 62,304,381 P1094S probably benign Het
Fpr1 A G 17: 17,877,617 S37P probably benign Het
Fryl G T 5: 73,108,493 T495K probably damaging Het
Gja6 A T X: 160,903,378 I186N possibly damaging Het
Gm4922 T C 10: 18,783,640 T445A probably benign Het
Gria2 G A 3: 80,802,357 L10F probably benign Het
Gspt2 A G X: 94,637,419 D388G possibly damaging Het
Hdc T A 2: 126,616,187 I72F probably damaging Het
Igf2r T C 17: 12,692,738 K1905E probably benign Het
Il33 A G 19: 29,956,904 D155G possibly damaging Het
Klk1b9 C T 7: 43,979,555 T161I probably benign Het
Mfsd12 C A 10: 81,357,681 H28Q probably damaging Het
Mgat5 A T 1: 127,459,959 I551F possibly damaging Het
Miga2 A T 2: 30,381,988 D25V probably damaging Het
Mlc1 T C 15: 88,974,579 N122S possibly damaging Het
Mmp20 T A 9: 7,645,292 M281K probably benign Het
Muc5ac C A 7: 141,813,152 P2232T possibly damaging Het
N4bp2l2 A G 5: 150,661,283 S411P possibly damaging Het
Ngef G A 1: 87,487,904 S346L probably damaging Het
Nov T A 15: 54,749,354 V253E probably benign Het
Olfr1217 T A 2: 89,023,143 T287S probably damaging Het
Olfr1309 T A 2: 111,984,084 M5L probably benign Het
Olfr1408 C T 1: 173,130,851 R122H possibly damaging Het
Olfr553 C T 7: 102,614,540 V150M probably damaging Het
Olfr612 T C 7: 103,538,359 I292V possibly damaging Het
Olfr661 T C 7: 104,688,483 I156T probably benign Het
Olfr720 A G 14: 14,175,854 I76T probably benign Het
Olfr782 T A 10: 129,350,692 I43N probably damaging Het
Olfr811 T C 10: 129,801,661 Y288C probably damaging Het
Papd5 C T 8: 88,246,484 T277M probably damaging Het
Pecam1 G T 11: 106,695,937 H150N possibly damaging Het
Polr3c A T 3: 96,714,373 probably null Het
Pop1 A C 15: 34,530,471 Q1005P probably damaging Het
Prss22 G A 17: 23,996,314 P163S probably damaging Het
Prss33 G A 17: 23,834,198 A223V probably damaging Het
Prss53 C T 7: 127,887,393 V354I probably benign Het
Rab3gap2 C T 1: 185,236,024 T191I probably damaging Het
Rictor T C 15: 6,776,156 F608L probably benign Het
Ryr3 T A 2: 112,654,492 E3884V probably null Het
Scaf11 G A 15: 96,418,840 R948* probably null Het
Sec61g A T 11: 16,506,444 V40E probably damaging Het
Serpinb3d A T 1: 107,080,788 F116I possibly damaging Het
Sipa1l3 T C 7: 29,399,611 D411G probably benign Het
Slc13a3 T C 2: 165,434,064 N254S possibly damaging Het
Slc35a2 T A X: 7,892,825 L110Q probably damaging Het
Spata31d1b G C 13: 59,716,380 L447F probably benign Het
Spsb2 T C 6: 124,809,366 probably null Het
Tmcc3 T C 10: 94,578,606 S57P possibly damaging Het
Traf7 A G 17: 24,510,502 V445A probably damaging Het
Trib1 A G 15: 59,649,343 S61G possibly damaging Het
Trip12 A T 1: 84,749,172 F36I probably damaging Het
Tshz3 T C 7: 36,769,822 I412T probably damaging Het
Tsku T C 7: 98,352,146 Y326C probably damaging Het
Ttc30b A G 2: 75,938,058 L117P probably damaging Het
Ttn T G 2: 76,881,694 probably benign Het
Ugt1a6a G A 1: 88,138,748 R92H probably benign Het
Vmn1r63 A G 7: 5,803,255 V126A probably benign Het
Vmn2r84 T A 10: 130,386,009 S781C probably damaging Het
Wdr91 T A 6: 34,892,362 H409L probably damaging Het
Wnt7a T A 6: 91,365,956 T315S possibly damaging Het
Zdhhc25 A G 15: 88,600,824 T121A probably benign Het
Zfp109 T C 7: 24,229,318 H222R probably benign Het
Zfp286 A G 11: 62,779,820 S476P probably damaging Het
Zfp605 T C 5: 110,127,552 Y179H probably damaging Het
Zfp955a T C 17: 33,241,646 H504R probably damaging Het
Zswim2 T A 2: 83,915,663 N477I possibly damaging Het
Other mutations in Abcb11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Abcb11 APN 2 69284681 missense possibly damaging 0.90
IGL01407:Abcb11 APN 2 69245944 missense probably damaging 1.00
IGL01583:Abcb11 APN 2 69296409 missense possibly damaging 0.81
IGL01813:Abcb11 APN 2 69287592 splice site probably benign
IGL01885:Abcb11 APN 2 69287627 missense probably damaging 1.00
IGL01937:Abcb11 APN 2 69287612 missense probably damaging 1.00
IGL02058:Abcb11 APN 2 69243498 missense probably damaging 0.98
IGL02117:Abcb11 APN 2 69323825 splice site probably benign
IGL02119:Abcb11 APN 2 69328000 critical splice acceptor site probably null
IGL02120:Abcb11 APN 2 69257310 missense probably damaging 1.00
IGL02158:Abcb11 APN 2 69299925 missense probably damaging 0.96
IGL02212:Abcb11 APN 2 69248889 missense probably damaging 0.97
IGL02306:Abcb11 APN 2 69265457 nonsense probably null
IGL02505:Abcb11 APN 2 69245761 missense probably damaging 1.00
IGL02538:Abcb11 APN 2 69306605 missense possibly damaging 0.67
IGL02793:Abcb11 APN 2 69291949 missense possibly damaging 0.90
IGL02863:Abcb11 APN 2 69284682 missense probably damaging 0.99
IGL02875:Abcb11 APN 2 69291949 missense possibly damaging 0.90
IGL03164:Abcb11 APN 2 69291999 nonsense probably null
IGL03181:Abcb11 APN 2 69328008 intron probably benign
3-1:Abcb11 UTSW 2 69327993 missense probably benign 0.00
FR4737:Abcb11 UTSW 2 69243518 missense probably damaging 0.97
R0031:Abcb11 UTSW 2 69285308 missense probably damaging 1.00
R0398:Abcb11 UTSW 2 69286666 missense probably null 0.82
R0413:Abcb11 UTSW 2 69328011 intron probably benign
R0437:Abcb11 UTSW 2 69257295 missense probably damaging 1.00
R0496:Abcb11 UTSW 2 69277884 splice site probably benign
R0646:Abcb11 UTSW 2 69285283 missense probably damaging 1.00
R0669:Abcb11 UTSW 2 69329318 missense probably benign 0.15
R0856:Abcb11 UTSW 2 69323918 missense probably benign
R1061:Abcb11 UTSW 2 69277809 missense probably benign 0.00
R1460:Abcb11 UTSW 2 69257374 splice site probably benign
R1714:Abcb11 UTSW 2 69306581 missense probably damaging 0.99
R1739:Abcb11 UTSW 2 69261566 missense probably damaging 1.00
R1856:Abcb11 UTSW 2 69245923 missense probably damaging 1.00
R2086:Abcb11 UTSW 2 69259476 splice site probably benign
R2133:Abcb11 UTSW 2 69323883 missense possibly damaging 0.65
R2516:Abcb11 UTSW 2 69329329 missense possibly damaging 0.88
R2930:Abcb11 UTSW 2 69257358 missense probably damaging 0.96
R3771:Abcb11 UTSW 2 69329376 splice site probably benign
R3772:Abcb11 UTSW 2 69329376 splice site probably benign
R3979:Abcb11 UTSW 2 69323976 missense probably benign 0.11
R4227:Abcb11 UTSW 2 69284776 missense probably damaging 1.00
R4255:Abcb11 UTSW 2 69306605 missense probably benign 0.03
R4614:Abcb11 UTSW 2 69284681 missense possibly damaging 0.90
R4647:Abcb11 UTSW 2 69285271 missense probably damaging 1.00
R4719:Abcb11 UTSW 2 69259627 missense probably damaging 1.00
R4734:Abcb11 UTSW 2 69323962 missense possibly damaging 0.73
R4765:Abcb11 UTSW 2 69245867 missense probably damaging 1.00
R4861:Abcb11 UTSW 2 69245905 missense probably damaging 1.00
R4861:Abcb11 UTSW 2 69245905 missense probably damaging 1.00
R4870:Abcb11 UTSW 2 69239196 missense probably damaging 0.99
R4988:Abcb11 UTSW 2 69323892 missense probably benign 0.12
R5028:Abcb11 UTSW 2 69274012 missense probably damaging 1.00
R5048:Abcb11 UTSW 2 69308506 missense probably benign 0.06
R5177:Abcb11 UTSW 2 69285295 missense probably damaging 1.00
R5301:Abcb11 UTSW 2 69286847 missense probably damaging 0.98
R5789:Abcb11 UTSW 2 69245764 missense probably damaging 1.00
R5892:Abcb11 UTSW 2 69261500 missense probably damaging 0.99
R6003:Abcb11 UTSW 2 69243467 missense probably benign 0.43
R6252:Abcb11 UTSW 2 69291961 missense probably benign 0.10
R6389:Abcb11 UTSW 2 69323894 missense probably damaging 1.00
R6512:Abcb11 UTSW 2 69282652 missense probably benign
R6590:Abcb11 UTSW 2 69284718 missense probably damaging 1.00
R6690:Abcb11 UTSW 2 69284718 missense probably damaging 1.00
R6732:Abcb11 UTSW 2 69286846 missense probably damaging 1.00
R6870:Abcb11 UTSW 2 69285298 missense possibly damaging 0.91
R7028:Abcb11 UTSW 2 69265675 missense probably benign
R7223:Abcb11 UTSW 2 69274143 missense probably benign
R7323:Abcb11 UTSW 2 69287635 missense probably damaging 1.00
R7337:Abcb11 UTSW 2 69245769 missense probably damaging 1.00
R7339:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7340:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7341:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7343:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7366:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7393:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7394:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7405:Abcb11 UTSW 2 69287619 missense probably damaging 1.00
R7411:Abcb11 UTSW 2 69303936 critical splice donor site probably null
R7488:Abcb11 UTSW 2 69277802 missense probably benign
R7544:Abcb11 UTSW 2 69265486 missense probably benign 0.05
R7754:Abcb11 UTSW 2 69286818 missense probably damaging 1.00
R7771:Abcb11 UTSW 2 69239191 missense probably damaging 0.99
R7794:Abcb11 UTSW 2 69286678 missense possibly damaging 0.62
X0058:Abcb11 UTSW 2 69289443 missense probably benign 0.12
X0062:Abcb11 UTSW 2 69245906 missense probably damaging 1.00
X0065:Abcb11 UTSW 2 69299866 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCTTCTTGGACCTGAGATATTGC -3'
(R):5'- CAAGTCAATCTTACTGAGTATTTTGGG -3'

Sequencing Primer
(F):5'- CTTGGACCTGAGATATTGCCAAAGC -3'
(R):5'- ATCTTACTGAGTATTTTGGGGTTTTG -3'
Posted On2014-08-25